Transcript: Mouse XM_006498051.1

PREDICTED: Mus musculus angiopoietin-like 2 (Angptl2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Angptl2 (26360)
Length:
3524
CDS:
604..2085

Additional Resources:

NCBI RefSeq record:
XM_006498051.1
NBCI Gene record:
Angptl2 (26360)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006498051.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339664 AGCCAGAAAGCGAGTACTATA pLKO_005 1763 CDS 100% 13.200 9.240 N Angptl2 n/a
2 TRCN0000339662 AGGAACTGGGAGACCTATAAG pLKO_005 1594 CDS 100% 13.200 9.240 N Angptl2 n/a
3 TRCN0000339663 CAGAGTCTTCCAATCAGTTAA pLKO_005 2293 3UTR 100% 13.200 9.240 N Angptl2 n/a
4 TRCN0000191301 CGTAAAGTCTTTGCTGAGTAT pLKO.1 1726 CDS 100% 4.950 3.465 N Angptl2 n/a
5 TRCN0000190014 GACGAACCAAGGCAACTACAA pLKO.1 1674 CDS 100% 4.950 3.465 N Angptl2 n/a
6 TRCN0000339734 GACGAACCAAGGCAACTACAA pLKO_005 1674 CDS 100% 4.950 3.465 N Angptl2 n/a
7 TRCN0000191723 GAGAGAGTACATTTACCTCAA pLKO.1 708 CDS 100% 4.050 2.835 N Angptl2 n/a
8 TRCN0000339733 GAGAGAGTACATTTACCTCAA pLKO_005 708 CDS 100% 4.050 2.835 N Angptl2 n/a
9 TRCN0000192721 GCTCAACAATGAGCTGCTTAA pLKO.1 876 CDS 100% 1.080 0.756 N Angptl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006498051.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02770 pDONR223 100% 89.3% 95.3% None (many diffs) n/a
2 ccsbBroad304_02770 pLX_304 0% 89.3% 95.3% V5 (many diffs) n/a
3 TRCN0000470699 GTTCCCTTATTGAATTCTAGTAAC pLX_317 22.6% 89.3% 95.3% V5 (many diffs) n/a
Download CSV