Construct: ORF TRCN0000470828
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009273.1_s317c1
- Derived from:
- ccsbBroadEn_00100
- DNA Barcode:
- TCCTCACTACTCACCTTACTTCTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RHOA (387)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470828
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 387 | RHOA | ras homolog family member A | NM_001313941.2 | 100% | 100% | |
| 2 | human | 387 | RHOA | ras homolog family member A | NM_001664.4 | 100% | 100% | |
| 3 | human | 387 | RHOA | ras homolog family member A | NM_001313944.2 | 89.6% | 89.6% | 128_129ins60 |
| 4 | human | 389 | RHOC | ras homolog family member C | NM_001042678.1 | 77.5% | 91.7% | (many diffs) |
| 5 | human | 389 | RHOC | ras homolog family member C | NM_001042679.1 | 77.5% | 91.7% | (many diffs) |
| 6 | human | 389 | RHOC | ras homolog family member C | NM_175744.4 | 77.5% | 91.7% | (many diffs) |
| 7 | human | 387 | RHOA | ras homolog family member A | NM_001313943.2 | 76.2% | 69.3% | (many diffs) |
| 8 | human | 387 | RHOA | ras homolog family member A | NM_001313945.2 | 58% | 58% | 0_1ins243 |
| 9 | human | 387 | RHOA | ras homolog family member A | NM_001313946.2 | 56.4% | 56.4% | 150_151ins252 |
| 10 | human | 387 | RHOA | ras homolog family member A | NM_001313947.2 | 46.6% | 24.6% | 154_155ins121;270_271ins188 |
| 11 | mouse | 11848 | Rhoa | ras homolog family member A | NM_001313961.1 | 93.7% | 99.4% | (many diffs) |
| 12 | mouse | 11848 | Rhoa | ras homolog family member A | NM_001313962.1 | 93.7% | 99.4% | (many diffs) |
| 13 | mouse | 11848 | Rhoa | ras homolog family member A | NM_016802.5 | 93.7% | 99.4% | (many diffs) |
| 14 | mouse | 11853 | Rhoc | ras homolog family member C | NM_001291859.1 | 77.4% | 91.7% | (many diffs) |
| 15 | mouse | 11853 | Rhoc | ras homolog family member C | NM_007484.2 | 77.4% | 91.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 645
- ORF length:
- 579
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc tgccatccgg aagaaactgg tgattgttgg tgatggagcc tgtggaaaga 121 catgcttgct catagtcttc agcaaggacc agttcccaga ggtgtatgtg cccacagtgt 181 ttgagaacta tgtggcagat atcgaggtgg atggaaagca ggtagagttg gctttgtggg 241 acacagctgg gcaggaagat tatgatcgcc tgaggcccct ctcctaccca gataccgatg 301 ttatactgat gtgtttttcc atcgacagcc ctgatagttt agaaaacatc ccagaaaagt 361 ggacccCAGA AGTCAAGCAT TTCTGTCCCA ACGTGCCCAT CATCCTGGTT GGGAATAAGA 421 AGGATCTTCG GAATGATGAG CACACAAGGC GGGAGCTAGC CAAGATGAAG CAGGAGCCGG 481 TGAAACCTGA AGAAGGCAGA GATATGGCAA ACAGGATTGG CGCTTTTGGG TACATGGAGT 541 GTTCAGCAAA GACCAAAGAT GGAGTGAGAG AGGTTTTTGA AATGGCTACG AGAGCTGCTC 601 TGCAAGCTAG ACGTGGGAAG AAAAAATCTG GGTGCCTTGT CTTGTGCCCA ACTTTCTTGT 661 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 721 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 781 GAAAGGACGA TCCTCACTAC TCACCTTACT TCTGACGCGT TAAGTCgaca atcaacctct 841 ggattacaaa atttgtgaaa gatt