Transcript: Human NM_001313944.2

Homo sapiens ras homolog family member A (RHOA), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RHOA (387)
Length:
1745
CDS:
160..681

Additional Resources:

NCBI RefSeq record:
NM_001313944.2
NBCI Gene record:
RHOA (387)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001313944.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068198 CCCAGACTAGATGTAGTATTT pLKO.1 1273 3UTR 100% 13.200 10.560 N Rhoa n/a
2 TRCN0000047708 CGATGTTATACTGATGTGTTT pLKO.1 330 CDS 100% 4.950 3.960 N RHOA n/a
3 TRCN0000047711 TGGAAAGACATGCTTGCTCAT pLKO.1 207 CDS 100% 4.050 3.240 N RHOA n/a
4 TRCN0000047710 GTACATGGAGTGTTCAGCAAA pLKO.1 564 CDS 100% 4.950 3.465 N RHOA n/a
5 TRCN0000047709 GTTGGGAATAAGAAGGATCTT pLKO.1 442 CDS 100% 4.950 3.465 N RHOA n/a
6 TRCN0000068202 GCTTGCTCATAGTCTTCAGCA pLKO.1 218 CDS 100% 2.640 1.848 N Rhoa n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001313944.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05846 pDONR223 100% 89.6% 89.6% None 128_129ins60 n/a
2 ccsbBroad304_05846 pLX_304 0% 89.6% 89.6% V5 128_129ins60 n/a
3 TRCN0000468837 ACCATGCGGCATTATCTTCCCCGG pLX_317 80.8% 89.6% 89.6% V5 128_129ins60 n/a
4 ccsbBroadEn_00100 pDONR223 100% 89.6% 89.6% None 128_129ins60 n/a
5 ccsbBroad304_00100 pLX_304 98.4% 89.6% 89.6% V5 128_129ins60 n/a
6 TRCN0000470828 TCCTCACTACTCACCTTACTTCTG pLX_317 48.2% 89.6% 89.6% V5 128_129ins60 n/a
7 ccsbBroadEn_00101 pDONR223 100% 69.1% 81.3% None (many diffs) n/a
8 ccsbBroad304_00101 pLX_304 0% 69.1% 81.3% V5 (many diffs) n/a
9 TRCN0000471226 GTCTCTCTAATTTTTACGCCATTT pLX_317 81.9% 69.1% 81.3% V5 (many diffs) n/a
Download CSV