Construct: ORF TRCN0000470833
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002008.1_s317c1
- Derived from:
- ccsbBroadEn_05027
- DNA Barcode:
- TTGTTAACCTGCAACCGGCCATCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CCDC24 (149473)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470833
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 149473 | CCDC24 | coiled-coil domain containi... | NM_152499.4 | 100% | 100% | |
| 2 | human | 149473 | CCDC24 | coiled-coil domain containi... | NM_001349127.1 | 97.5% | 78.3% | 698_699insCAGG;918_936del |
| 3 | human | 149473 | CCDC24 | coiled-coil domain containi... | NM_001349128.1 | 95.6% | 95.6% | 300_338del;455_456insCAG |
| 4 | human | 149473 | CCDC24 | coiled-coil domain containi... | NM_001349129.1 | 56.3% | 56.3% | 0_1ins399;17_18insCAG |
| 5 | human | 149473 | CCDC24 | coiled-coil domain containi... | NR_146064.2 | 46.4% | 1_53del;177_178ins296;679_1049del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 987
- ORF length:
- 921
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgct ccggcactcc ccctcgctgt gggagctggt ggaggagcac gttccgctcc 121 gggagcgacg cgaagtgaag aggattctgg gggaggcggc ggtggacctg agcctggagc 181 tgcgggcgga ggtggcgatg ttacgggcac tgctccaaga ggctcgatcc tctcaagccc 241 ccagctcccg ccccatctct gacccctctt ctcttctggc accaccgcct ctcctaaagg 301 acctcttgcg ccaggagctc cggcagttgc tccagggtct ccgccacaaa gccatctgtg 361 agggcaggga ccaggcccaa gcttgggtcc agtatagccc cagggtcctg cactttgcct 421 tggaggagcc caggtgtgat ttgccagaac aggagatatt ccagatgaga ggtggtgggc 481 ccagcagcgg tcacagagat ctcagcatca tcaaggacca actgaacgtg tccaacattg 541 accaggtggc cagacacctg aggggccTTC TGGAGGAGGA GTGTCACACC TTGGAGAGGG 601 AGATCCTCAT CCTGCAGCGC TGCCTGGAAG AGGAGTATTT GAGGCCTTGC CACCCCTCTG 661 AGGCAGCCCT GGAGCCCACC CTGGCAGAGC TAAAGGAACA GAAGAAGGCC ATGGAGCAGG 721 AGCTGCAGGC ATCTGTGGGG CCTTCTTGTG TCTCTCCCAA CCACAGGCAG CGGCCCTTGG 781 GGTCCTCCAC ACAGGGCCTC AGACCCCCGC TTCCCCTCTG CGGGGTTGCA CCTCTCCAGT 841 GCTGCCTGCC TGCACCTCCT CTGGAGCCCT ACCTTCGACC TCGAGGCCAG TCGGCTACCC 901 ACCGCTGGGG ACGGCAGCTT CAGTGCAGCC CCAGGGAAGG GCCAGCTTCC ACACCCATGT 961 CCAGTGCAGC ACCCCAAGCC CCAGCCTGCC CAACTTTCTT GTACAAAGTG GTTGATATCG 1021 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1081 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GATTGTTAAC 1141 CTGCAACCGG CCATCAACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1201 aagatt