Transcript: Human NM_001349129.1

Homo sapiens coiled-coil domain containing 24 (CCDC24), transcript variant 4, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
CCDC24 (149473)
Length:
1145
CDS:
256..777

Additional Resources:

NCBI RefSeq record:
NM_001349129.1
NBCI Gene record:
CCDC24 (149473)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001349129.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000172893 GTGTGATTTGCCAGAACAGGA pLKO.1 225 5UTR 100% 2.640 2.112 N CCDC24 n/a
2 TRCN0000242897 ATTTGCCAGAACAGGAGATAT pLKO_005 230 5UTR 100% 13.200 9.240 N CCDC24 n/a
3 TRCN0000242895 CTGCCTGGAAGAGGAGTATTT pLKO_005 408 CDS 100% 13.200 9.240 N CCDC24 n/a
4 TRCN0000242898 CATCGGTCCCAAGCATCAAAG pLKO_005 972 3UTR 100% 10.800 7.560 N CCDC24 n/a
5 TRCN0000242896 CCAAGCTTGGGTCCAGTATAG pLKO_005 168 5UTR 100% 10.800 7.560 N CCDC24 n/a
6 TRCN0000242894 CGCGAAGTGAAGAGGATTCTG pLKO_005 96 5UTR 100% 4.950 3.465 N CCDC24 n/a
7 TRCN0000172975 GAACGTGTCCAACATTGACCA pLKO.1 312 CDS 100% 2.640 1.848 N CCDC24 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001349129.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05027 pDONR223 100% 56.3% 56.3% None 0_1ins399;17_18insCAG n/a
2 ccsbBroad304_05027 pLX_304 0% 56.3% 56.3% V5 0_1ins399;17_18insCAG n/a
3 TRCN0000470833 TTGTTAACCTGCAACCGGCCATCA pLX_317 45.6% 56.3% 56.3% V5 0_1ins399;17_18insCAG n/a
Download CSV