Construct: ORF TRCN0000470836
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019048.3_s317c1
- Derived from:
- ccsbBroadEn_14845
- DNA Barcode:
- TCAGTGGTTTCCGGGGAGTTCTCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SRC (6714)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470836
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 6714 | SRC | SRC proto-oncogene, non-rec... | NM_005417.4 | 100% | 100% | |
| 2 | human | 6714 | SRC | SRC proto-oncogene, non-rec... | NM_198291.2 | 100% | 100% | |
| 3 | human | 6714 | SRC | SRC proto-oncogene, non-rec... | XM_011529013.2 | 99.9% | 100% | 1218G>C |
| 4 | human | 6714 | SRC | SRC proto-oncogene, non-rec... | XM_017028024.1 | 98.8% | 98.8% | 351_368del;1236G>C |
| 5 | human | 6714 | SRC | SRC proto-oncogene, non-rec... | XM_017028025.1 | 98.8% | 98.8% | 351_368del;1236G>C |
| 6 | human | 6714 | SRC | SRC proto-oncogene, non-rec... | XM_017028026.1 | 98.8% | 98.8% | 351_368del;1236G>C |
| 7 | human | 6714 | SRC | SRC proto-oncogene, non-rec... | XM_017028027.2 | 98.8% | 98.8% | 351_368del;1236G>C |
| 8 | mouse | 20779 | Src | Rous sarcoma oncogene | NM_001025395.2 | 90% | 98.8% | (many diffs) |
| 9 | mouse | 20779 | Src | Rous sarcoma oncogene | NM_009271.3 | 89% | 97.7% | (many diffs) |
| 10 | mouse | 20779 | Src | Rous sarcoma oncogene | XM_006499063.3 | 87.3% | 95.8% | (many diffs) |
| 11 | mouse | 20779 | Src | Rous sarcoma oncogene | XM_006499065.3 | 87.3% | 95.8% | (many diffs) |
| 12 | mouse | 20779 | Src | Rous sarcoma oncogene | XM_006499066.2 | 87.3% | 95.8% | (many diffs) |
| 13 | mouse | 20779 | Src | Rous sarcoma oncogene | XM_011239402.2 | 87.3% | 95.8% | (many diffs) |
| 14 | mouse | 20779 | Src | Rous sarcoma oncogene | XM_011239403.2 | 87.3% | 95.8% | (many diffs) |
| 15 | mouse | 20779 | Src | Rous sarcoma oncogene | XM_011239404.1 | 87.3% | 95.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1677
- ORF length:
- 1608
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gggtagcaac aagagcaagc ccaaggatgc cagccagcgg cgccgcagcc 121 tggagcccgc cgagaacgtg cacggcgctg gcgggggcgc tttccccgcc tcgcagaccc 181 ccagcaagcc agcctcggcc gacggccacc gcggccccag cgcggccttc gcccccgcgg 241 ccgccgagcc caagctgttc ggaggcttca actcctcgga caccgtcacc tccccgcaga 301 gggcgggccc gctggccggt ggagtgacca cctttgtggc cctctatgac tatgagtcta 361 ggacggagac agacctgtcc ttcaagaaag gcgagcggct ccagattgtc aacaacacag 421 agggagactg gtggctggcc cactcgctca gcacaggaca gacaggctac atccccagca 481 actacgtggc gccctccgac tccatccagg ctgaggagtg gtattttggc aagatcacca 541 gacgggagtc agagcggtta ctgctcaatg cagagaaccc gagagggacc ttcctcgtgc 601 gagaaagtga gaccacgaaa ggtgcctact gcctctcagt gtctgacttc gacaacgcca 661 agggcctcaa cgtgaagcac tacaagatcc gcaagctgga cagcggcggc ttctacatca 721 cctcccgcac ccagttcaac agcctgcagc agctggtggc ctactactcc aaacacgccg 781 atggcctgtg ccaccgcctc accaccgtgt gccccacgtc caagccgcag actcagggcc 841 tggccaagga tgcctgggag atccctcggg agtcgctgcg gctggaggtc aagctgggcc 901 agggctgctt tggcgaggtg tggatgggga cctggaacgg taccaccagg gtggccatca 961 aaaccctgaa gcctggcacg atgtctccag aggccttcct gcaggaggcc caggtcatga 1021 agaagctgag gcatgagaag ctggtgcagt tgtatgctgt ggtttcagag gagcccattt 1081 acatcgtcac ggagtacatg agcaagggga gtttgctgga ctttctcaag ggggagacag 1141 gcaagtacct gcggctgcct cagctggtgg acatggctgc tcagatcgcc tcaggcatgg 1201 cgtacgtgga gcggatgaac tacgtccacc gggaccttcg tgcagccaac atcctggtgg 1261 gagagaacct ggtgtgcaaa gtggccgact ttgggctggc tcggctcatt GAAGACAATG 1321 AGTACACGGC GCGGCAAGGT GCCAAATTCC CCATCAAGTG GACGGCTCCA GAAGCTGCCC 1381 TCTATGGCCG CTTCACCATC AAGTCGGACG TGTGGTCCTT CGGGATCCTG CTGACTGAGC 1441 TCACCACAAA GGGACGGGTG CCCTACCCTG GGATGGTGAA CCGCGAGGTG CTGGACCAGG 1501 TGGAGCGGGG CTACCGGATG CCCTGCCCGC CGGAGTGTCC CGAGTCCCTG CACGACCTCA 1561 TGTGCCAGTG CTGGCGGAAG GAGCCTGAGG AGCGGCCCAC CTTCGAGTAC CTGCAGGCCT 1621 TCCTGGAGGA CTACTTCACG TCCACCGAGC CCCAGTACCA GCCCGGGGAG AACCTCTACC 1681 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 1741 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 1801 ATATATCTTG TGGAAAGGAC GATCAGTGGT TTCCGGGGAG TTCTCGACGC GTTAAGTCga 1861 caatcaacct ctggattaca aaatttgtga aagatt