Construct: ORF TRCN0000471006
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004444.1_s317c1
- Derived from:
- ccsbBroadEn_03722
- DNA Barcode:
- TAATGATATGGCATCATTCTATTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CTPS2 (56474)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471006
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 56474 | CTPS2 | CTP synthase 2 | NM_001144002.1 | 100% | 100% | |
| 2 | human | 56474 | CTPS2 | CTP synthase 2 | NM_019857.5 | 100% | 100% | |
| 3 | human | 56474 | CTPS2 | CTP synthase 2 | NM_175859.3 | 100% | 100% | |
| 4 | human | 56474 | CTPS2 | CTP synthase 2 | XM_005274562.3 | 100% | 100% | |
| 5 | human | 56474 | CTPS2 | CTP synthase 2 | XM_006724503.3 | 100% | 100% | |
| 6 | human | 56474 | CTPS2 | CTP synthase 2 | XM_024452408.1 | 100% | 100% | |
| 7 | human | 56474 | CTPS2 | CTP synthase 2 | XM_024452409.1 | 100% | 100% | |
| 8 | human | 56474 | CTPS2 | CTP synthase 2 | XM_011545545.2 | 93.3% | 93.3% | 1_126del |
| 9 | human | 56474 | CTPS2 | CTP synthase 2 | XR_002958784.1 | 42.5% | 1_374del;1670_1853del;2317_4131del | |
| 10 | mouse | 55936 | Ctps2 | cytidine 5'-triphosphate sy... | NM_001168568.1 | 87.6% | 90.4% | (many diffs) |
| 11 | mouse | 55936 | Ctps2 | cytidine 5'-triphosphate sy... | NM_001168569.1 | 87.6% | 90.4% | (many diffs) |
| 12 | mouse | 55936 | Ctps2 | cytidine 5'-triphosphate sy... | NM_018737.5 | 87.6% | 90.4% | (many diffs) |
| 13 | mouse | 55936 | Ctps2 | cytidine 5'-triphosphate sy... | XM_006528912.2 | 87.6% | 90.4% | (many diffs) |
| 14 | mouse | 55936 | Ctps2 | cytidine 5'-triphosphate sy... | XM_006528913.2 | 87.6% | 90.4% | (many diffs) |
| 15 | mouse | 55936 | Ctps2 | cytidine 5'-triphosphate sy... | XM_006528911.2 | 80.9% | 83.4% | (many diffs) |
| 16 | mouse | 55936 | Ctps2 | cytidine 5'-triphosphate sy... | NM_001168571.1 | 80.6% | 83.6% | (many diffs) |
| 17 | mouse | 55936 | Ctps2 | cytidine 5'-triphosphate sy... | XM_006528915.1 | 68.1% | 69.2% | (many diffs) |
| 18 | mouse | 55936 | Ctps2 | cytidine 5'-triphosphate sy... | NR_033143.1 | 28.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1824
- ORF length:
- 1758
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa gtacatcctg gtcacgggtg gggtcatctc aggcattggt aaagggatca 121 ttgccagcag cattggaacg attctaaaat catgtggact ccgagttact gccataaaaa 181 tcgaccccta tattaacatc gatgctggca ctttttcacc ttatgaacac ggtgaagtct 241 tcgtcttaaa tgatggtgga gaagttgatt tagaccttgg aaattatgaa agatttttgg 301 atattaatct ttataaagac aacaatatca ccacggggaa gatatatcag catgtgatca 361 ataaagagag gcgtggtgat tacctgggga aaacagtgca agttgtccct cacattactg 421 atgctgtcca ggagtgggtt atgaatcaag ccaaggtgcc ggtggatggt aataaggaag 481 agccccaaat atgcgttatt gagctgggag gcaccattgg agacatcgaa ggaatgccgt 541 ttgtggaggc gtttagacaa ttccagttta aggcgaaaag agagaatttc tgtaatatcc 601 acgttagcct tgtcccacag ctcagtgcta ccggagaaca aaaaaccaaa cccacccaaa 661 acagcgtccg cgcactgagg ggtttaggcc tgtctccaga tctgattgtc tgccgaagtt 721 caacgcccat tgagatggcc gtgaaggaga agatttctat gttttgtcac gtgaaccctg 781 aacaggtcat atgtatccat gatgtttctt ccacataccg agttcctgtg cttttagagg 841 aacaaagcat tgtgaaatat tttaaggaga gattgcacct gcccatcggt gattctgcaa 901 gtaatttgct ttttaagtgg agaaatatgg ctgacaggta tgaaaggtta cagaaaatat 961 gctccatagc cctggttggc aaatacacca agctcagaga ctgctacgcc tctgtgttca 1021 aagccctgga acactcagcc ctggccatca accacaagtt gaatctgatg tacatagact 1081 ccattgatct ggagaagatc actgaaaccg aggaccctgt gaaatttcat gaagcttggc 1141 agaagctatg caaagctgat ggtattcttg tgcctggagg ctttggaatc agaggaacat 1201 tgggaaaact ccaggcgatt tcttgggcaa ggacaaagaa gattcctttt ctgggagttt 1261 gtcttgggat gcaactagca gtgatagagt ttgcaagaaa ctgccttaac ttgaaagatg 1321 ctgattccac agagtttagg ccaaatgccc cagttcctct ggtgattgat atgcccgagc 1381 acaacccTGG CAATTTGGGA GGAACAATGA GACTGGGAAT AAGAAGAACT GTTTTCAAAA 1441 CTGAAAATTC AATATTAAGG AAACTTTATG GTGATGTTCC TTTTATAGAA GAAAGACACA 1501 GACATCGGTT CGAGGTAAAC CCTAACCTGA TCAAACAATT TGAGCAGAAT GACTTAAGTT 1561 TTGTAGGTCA GGATGTTGAT GGAGACAGGA TGGAAATCAT TGAACTGGCA AATCATCCTT 1621 ATTTTGTTGG TGTCCAGTTC CATCCTGAGT TTTCTTCTAG GCCGATGAAG CCTTCCCCTC 1681 CGTATCTGGG GCTGTTACTT GCAGCAACTG GGAACCTGAA TGCCTACTTG CAACAGGGTT 1741 GCAAACTGTC TTCCAGTGAT AGATACAGTG ATGCCAGTGA TGACAGCTTT TCAGAGCCAA 1801 GGATAGCTGA GTTGGAAATA AGCTGCCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1861 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1921 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAT AATGATATGG 1981 CATCATTCTA TTAACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 2041 att