Transcript: Mouse XM_006528913.2

PREDICTED: Mus musculus cytidine 5'-triphosphate synthase 2 (Ctps2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ctps2 (55936)
Length:
3532
CDS:
334..2094

Additional Resources:

NCBI RefSeq record:
XM_006528913.2
NBCI Gene record:
Ctps2 (55936)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006528913.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348467 GTTGACAAGTCATCCATATTT pLKO_005 1872 CDS 100% 15.000 21.000 N Ctps2 n/a
2 TRCN0000374765 CATAGCCCTGGTTGGTAAATA pLKO_005 1233 CDS 100% 15.000 12.000 N Ctps2 n/a
3 TRCN0000374695 GTCATCTCAGGCATTGGTAAA pLKO_005 361 CDS 100% 10.800 8.640 N Ctps2 n/a
4 TRCN0000075989 GCTGGAACTTTCTCACCTTAT pLKO.1 472 CDS 100% 10.800 7.560 N Ctps2 n/a
5 TRCN0000363776 GCTGGAACTTTCTCACCTTAT pLKO_005 472 CDS 100% 10.800 7.560 N Ctps2 n/a
6 TRCN0000075991 CCTTGGAAACTATGAAAGATT pLKO.1 543 CDS 100% 5.625 3.938 N Ctps2 n/a
7 TRCN0000334944 CCTTGGAAACTATGAAAGATT pLKO_005 543 CDS 100% 5.625 3.938 N Ctps2 n/a
8 TRCN0000075990 CCATCAATGATTGTTCAAGTA pLKO.1 1151 CDS 100% 4.950 3.465 N Ctps2 n/a
9 TRCN0000075992 GCTGCCATACAGTGATGGATA pLKO.1 2013 CDS 100% 4.950 3.465 N Ctps2 n/a
10 TRCN0000075988 GCTGTGAAGATTCAAAGAGAA pLKO.1 2207 3UTR 100% 4.950 3.465 N Ctps2 n/a
11 TRCN0000335015 GCTGTGAAGATTCAAAGAGAA pLKO_005 2207 3UTR 100% 4.950 3.465 N Ctps2 n/a
12 TRCN0000045364 GCCATCAACCACAAGTTGAAT pLKO.1 1312 CDS 100% 0.563 0.394 N CTPS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006528913.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03722 pDONR223 100% 87.6% 90.4% None (many diffs) n/a
2 ccsbBroad304_03722 pLX_304 0% 87.6% 90.4% V5 (many diffs) n/a
3 TRCN0000471006 TAATGATATGGCATCATTCTATTA pLX_317 25.1% 87.6% 90.4% V5 (many diffs) n/a
Download CSV