Construct: ORF TRCN0000471011
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009078.1_s317c1
- Derived from:
- ccsbBroadEn_12521
- DNA Barcode:
- AATCGTACGCTTTACGATTACAAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- KCTD14 (65987)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471011
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 65987 | KCTD14 | potassium channel tetrameri... | NM_001282406.1 | 100% | 100% | |
2 | human | 65987 | KCTD14 | potassium channel tetrameri... | NM_023930.4 | 88.2% | 88.2% | 1_90del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 741
- ORF length:
- 675
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc tactgttgtg gagctgaacg tcgggggtga gttccacacc accaccctgg 121 gtaccctgag gaagtttccg ggctcaaagc tggcagagat gttctctagc ttagccaagg 181 cctccacgga cgcggagggc cgcttcttca tcgaccgccc cagcacctat ttcagaccca 241 tcctggacta cctgcgcact gggcaagtgc ccacacagca catccctgaa gtgtaccgtg 301 aggctcagtt ctacgaaatc aagcctttgg tcaagctgct ggaggacatg ccacagatct 361 ttggtgagca ggtgtctcgg aagcagtttt tgctgcaagt gccgggctac agcgagaacc 421 tggagctcat ggtgcgcctg gcacgtgcag aagccataac agcacggaag tccagcgtgc 481 ttgtgtgcct ggtggaaact gaggagcagg atgcatatta ttcagaggtc ctgtgttttc 541 TGCAGGATAA GAAGATGTTC AAGTCTGTTG TCAAGTTTGG GCCCTGGAAG GCGGTCCTAG 601 ACAACAGCGA CCTCATGCAC TGCCTGGAGA TGGACATTAA GGCCCAGGGG TACAAGGTAT 661 TCTCCAAGTT CTACCTGACG TACCCCACCA AAAGAAACGA ATTCCATTTT AACATTTATT 721 CATTCACCTT CACCTGGTGG TGCCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 781 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 841 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAAATC GTACGCTTTA 901 CGATTACAAT ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt