Transcript: Human NM_001282406.1

Homo sapiens potassium channel tetramerization domain containing 14 (KCTD14), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-06-30
Taxon:
Homo sapiens (human)
Gene:
KCTD14 (65987)
Length:
1799
CDS:
227..904

Additional Resources:

NCBI RefSeq record:
NM_001282406.1
NBCI Gene record:
KCTD14 (65987)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282406.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365150 AGGAGCAGGATGCATATTATT pLKO_005 663 CDS 100% 15.000 7.500 Y KCTD14 n/a
2 TRCN0000365151 TGCAACTGATGCCACTATATT pLKO_005 1070 3UTR 100% 15.000 7.500 Y KCTD14 n/a
3 TRCN0000376578 ACTGCCTGGAGATGGACATTA pLKO_005 780 CDS 100% 13.200 6.600 Y KCTD14 n/a
4 TRCN0000370265 TCTAGAGTCTTGCCACTAAAT pLKO_005 1016 3UTR 100% 13.200 6.600 Y KCTD14 n/a
5 TRCN0000365153 AGGAAGTTTCCGGGCTCAAAG pLKO_005 290 CDS 100% 10.800 5.400 Y KCTD14 n/a
6 TRCN0000365152 AGGACATGCCACAGATCTTTG pLKO_005 504 CDS 100% 10.800 5.400 Y KCTD14 n/a
7 TRCN0000370212 TCAAGTCTGTTGTCAAGTTTG pLKO_005 720 CDS 100% 10.800 5.400 Y KCTD14 n/a
8 TRCN0000043760 CAAGGTATTCTCCAAGTTCTA pLKO.1 814 CDS 100% 4.950 2.475 Y KCTD14 n/a
9 TRCN0000043758 GCAGAGATGTTCTCTAGCTTA pLKO.1 314 CDS 100% 4.950 2.475 Y KCTD14 n/a
10 TRCN0000043761 CCTAGACAACAGCGACCTCAT pLKO.1 757 CDS 100% 4.050 2.025 Y KCTD14 n/a
11 TRCN0000043759 GTTCTACGAAATCAAGCCTTT pLKO.1 469 CDS 100% 4.050 2.025 Y KCTD14 n/a
12 TRCN0000043762 AGAAGCCATAACAGCACGGAA pLKO.1 610 CDS 100% 2.640 1.320 Y KCTD14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282406.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12521 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_12521 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471011 AATCGTACGCTTTACGATTACAAT pLX_317 30.3% 100% 100% V5 n/a
Download CSV