Construct: ORF TRCN0000471054
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004464.1_s317c1
- Derived from:
- ccsbBroadEn_10133
- DNA Barcode:
- GGCCAATATCTTGATCTGAATCCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- C9orf139 (401563)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471054
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 401563 | C9orf139 | chromosome 9 open reading f... | NM_207511.2 | 99.8% | 99.4% | 502A>G |
2 | human | 401563 | C9orf139 | chromosome 9 open reading f... | XM_017014717.1 | 99.8% | 99.4% | 502A>G |
3 | human | 401563 | C9orf139 | chromosome 9 open reading f... | XR_929799.1 | 16.5% | 1_488del;990A>G;1059_3434del | |
4 | human | 401563 | C9orf139 | chromosome 9 open reading f... | XR_001746294.1 | 16.5% | 1_488del;990A>G;1059_3439del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 639
- ORF length:
- 570
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggccctgcgg ggtcaccctg agccccagcc aaccaacacc ccactctcag 121 ccacagtggg aggccccatc agcctcttca cccaaccacg ttgccactct gctgcacggg 181 accttgtgtg gtcccaggcg tggccagacc cagacgtcct ggagatctca atgcagacac 241 ccggcggcag ttcctgcagg aaggaggctg tcctgccacg cctgcgggtg acccggcctc 301 tggtgccaga gcctgccatc cttcctgttt gtgctgccag gctggcaggg tcccttgcca 361 ccgacctcag ccgcagccac agcctgctcc ctccctgggt ggatttgaag gagcctcccc 421 caccctccgc ccctagcttg ctccttgagg accctgggca gggtggctgc catggggccc 481 aatcgtgcgt gggaacctgc gagctggcaa acggggctcg ggggttttgc ccagaaatgg 541 gtcagaacga aagcctcTCA GAGGAAAGAG AAGGGCATGA GTCAAAGAGA AAGTCGGGGG 601 GCAGGGGCTC CCCCTCATCT CACCCCACCC AGGCCTCCTT GCCAACTTTC TTGTACAAAG 661 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 721 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 781 ACGAGGCCAA TATCTTGATC TGAATCCGAC GCGTTAAGTC gacaatcaac ctctggatta 841 caaaatttgt gaaagatt