Transcript: Human XM_017014717.1

PREDICTED: Homo sapiens chromosome 9 open reading frame 139 (C9orf139), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C9orf139 (401563)
Length:
3643
CDS:
480..1052

Additional Resources:

NCBI RefSeq record:
XM_017014717.1
NBCI Gene record:
C9orf139 (401563)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017014717.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000163665 GACTGCCCTTATTCTCAGTAA pLKO.1 1454 3UTR 100% 4.950 6.930 N C9orf139 n/a
2 TRCN0000165071 GTGTGTGAGCATCGTGATGAT pLKO.1 1102 3UTR 100% 4.950 6.930 N C9orf139 n/a
3 TRCN0000164419 CAAGGTGAAATCTGCCTCTTA pLKO.1 2227 3UTR 100% 4.950 3.465 N C9orf139 n/a
4 TRCN0000164395 CAGAAATGGGTCAGAACGAAA pLKO.1 943 CDS 100% 4.950 3.465 N C9orf139 n/a
5 TRCN0000165256 GAAAGCCTCTCAGAGGAAAGA pLKO.1 960 CDS 100% 4.950 3.465 N C9orf139 n/a
6 TRCN0000161055 GAAGGTAAAGTGGAAAGGAAT pLKO.1 2286 3UTR 100% 4.950 3.465 N C9orf139 n/a
7 TRCN0000165495 GACAGGAACAGCAGAAGGTAA pLKO.1 2273 3UTR 100% 4.950 3.465 N C9orf139 n/a
8 TRCN0000165229 GAGCCAGAAACCAAGGTGAAA pLKO.1 2216 3UTR 100% 4.950 3.465 N C9orf139 n/a
9 TRCN0000162872 GCATGAGTCAAAGAGAAAGTC pLKO.1 986 CDS 100% 4.950 3.465 N C9orf139 n/a
10 TRCN0000164729 CCAAGGTGAAATCTGCCTCTT pLKO.1 2226 3UTR 100% 4.050 2.835 N C9orf139 n/a
11 TRCN0000166719 CTGGAGATCTCAATGCAGACA pLKO.1 630 CDS 100% 2.640 1.848 N C9orf139 n/a
12 TRCN0000162830 CAGCAGAAGGTAAAGTGGAAA pLKO.1 2281 3UTR 100% 4.950 2.970 N C9orf139 n/a
13 TRCN0000165714 CCAGAAATGGGTCAGAACGAA pLKO.1 942 CDS 100% 3.000 1.800 N C9orf139 n/a
14 TRCN0000164978 GTGGTGGCTTATGCCTGTAAT pLKO.1 2515 3UTR 100% 13.200 6.600 Y C9orf139 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017014717.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10133 pDONR223 100% 99.8% 99.4% None 502A>G n/a
2 ccsbBroad304_10133 pLX_304 0% 99.8% 99.4% V5 502A>G n/a
3 TRCN0000471054 GGCCAATATCTTGATCTGAATCCG pLX_317 15.5% 99.8% 99.4% V5 502A>G n/a
Download CSV