Construct: ORF TRCN0000471128
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010852.1_s317c1
- Derived from:
- ccsbBroadEn_01977
- DNA Barcode:
- AAAAGACTATGGGTAATGAGTTCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- AOC3 (8639)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471128
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8639 | AOC3 | amine oxidase copper contai... | NM_003734.4 | 100% | 100% | |
| 2 | human | 8639 | AOC3 | amine oxidase copper contai... | XM_011525419.2 | 96% | 96% | 1597_1689del |
| 3 | human | 8639 | AOC3 | amine oxidase copper contai... | NM_001277731.1 | 82.6% | 82.4% | (many diffs) |
| 4 | human | 8639 | AOC3 | amine oxidase copper contai... | XM_011525420.3 | 79.4% | 79.2% | (many diffs) |
| 5 | human | 90586 | AOC4P | amine oxidase copper contai... | NR_002773.1 | 67.5% | (many diffs) | |
| 6 | human | 8639 | AOC3 | amine oxidase copper contai... | NR_102422.2 | 54.8% | 1_145del;1741_1742ins89;2346_3922del | |
| 7 | human | 8639 | AOC3 | amine oxidase copper contai... | XR_001752673.2 | 54.8% | (many diffs) | |
| 8 | human | 8639 | AOC3 | amine oxidase copper contai... | XR_934584.2 | 51.5% | 1_162del;1758_2162del;2857_4439del | |
| 9 | human | 8639 | AOC3 | amine oxidase copper contai... | NM_001277732.1 | 28.8% | 28.8% | 0_1ins1629 |
| 10 | human | 8639 | AOC3 | amine oxidase copper contai... | XM_024451015.1 | 28.8% | 28.8% | 0_1ins1629 |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2355
- ORF length:
- 2289
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa ccagaagaca atcctcgtgc tcctcattct ggccgtcatc accatctttg 121 ccttggtttg tgtcctgctg gtgggcaggg gtggagatgg gggtgaaccc agccagcttc 181 cccattgccc ctctgtatct cccagtgccc agccttggac acaccctggc cagagccagc 241 tgtttgcaga cctgagccga gaggagctga cggctgtgat gcgctttctg acccagcggc 301 tggggccagg gctggtggat gcagcccagg cccggccctc ggacaactgt gtcttctcag 361 tggagttgca gctgcctccc aaggctgcag ccctggctca cttggacagg gggagccccc 421 cacctgcccg ggaggcactg gccatcgtct tctttggcag gcaaccccag cccaacgtga 481 gtgagctggt ggtggggcca ctgcctcacc cctcctacat gcgggacgtg actgtggagc 541 gtcatggagg ccccctgccc tatcaccgac gccccgtgct gttccaagag tacctggaca 601 tagaccagat gatcttcaac agagagctgc cccaggcttc tgggcttctc caccactgtt 661 gcttctacaa gcaccgggga cggaacctgg tgacaatgac cacggctccc cgtggtctgc 721 aatcagggga ccgggccacc tggtttggcc tctactacaa catctcgggc gctgggttct 781 tcctgcacca cgtgggcttg gagctgctag tgaaccacaa ggcccttgac cctgcccgct 841 ggactatcca gaaggtgttc tatcaaggcc gctactacga cagcctggcc cagctggagg 901 cccagtttga ggccggcctg gtgaatgtgg tgctgatccc agacaatggc acaggtgggt 961 cctggtccct gaagtcccct gtgcccccgg gtccagctcc ccctctacag ttctatcccc 1021 aaggcccccg cttcagtgtc cagggaagtc gagtggcctc ctcactgtgg actttctcct 1081 ttggcctcgg agcattcagt ggcccaagga tctttgacgt tcgcttccaa ggagaaagac 1141 tagtttatga gataagcctc caagaggcct tggccatcta tggtggaaat tccccagcag 1201 caatgacgac ccgctatgtg gatggaggct ttggcatggg caagtacacc acgcccctga 1261 cccgtggggt ggactgcccc tacttggcca cctacgtgga ctggcacttc cttttggagt 1321 cccaggcccc caagacaata cgtgatgcct tttgtgtgtt tgaacagaac cagggcctcc 1381 ccctgcggcg acaccactca gatctctact cgcactactt tgggggtctt gcggaaacgg 1441 tgctggtcgt cagatctatg tccaccttgc tcaactatga ctatgtgtgg gatacggtct 1501 tccaccccag tggggccata gaaatacgat tctatgccac gggctacatc agctcggcat 1561 tcctctttgg tgctactggg aagtacggga accaagtgtc agagcacacc ctgggcacgg 1621 tccacaccca cagcgcccac ttcaaggtgg atctggatgt agcaggactg gagaactggg 1681 tctgggccga ggatatggtc tttgtcccca tggctgtgcc ctggagccct gagcaccagc 1741 tgcagaggct gcaggtgacc cggaagctgc tggagatgga ggagcaggcc gccttcctcg 1801 tgggaagcgc cacccctcgc tacctgtacc tggccagcaa ccacagcaac aagtggggtc 1861 acccccgggg ctaccgcatc cagatgctca gctttgctgg agagccgctg ccccaaaaca 1921 gctccatggc gagaggcTTC AGCTGGGAGA GGTACCAGCT GGCTGTGACC CAGCGGAAGG 1981 AGGAGGAGCC CAGTAGCAGC AGCGTTTTCA ATCAGAATGA CCCTTGGGCC CCCACTGTGG 2041 ATTTCAGTGA CTTCATCAAC AATGAGACCA TTGCTGGAAA GGATTTGGTG GCCTGGGTGA 2101 CAGCTGGTTT TCTGCATATC CCACATGCAG AGGACATTCC TAACACAGTG ACTGTGGGGA 2161 ACGGCGTGGG CTTCTTCCTC CGACCCTATA ACTTCTTTGA CGAAGACCCC TCCTTCTACT 2221 CTGCCGACTC CATCTACTTC CGAGGGGACC AGGATGCTGG GGCCTGCGAG GTCAACCCCC 2281 TAGCTTGCCT GCCCCAGGCT GCTGCCTGTG CCCCCGACCT CCCTGCCTTC TCCCACGGGG 2341 GCTTCTCTCA CAACTACCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 2401 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 2461 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA AAAAGACTAT GGGTAATGAG 2521 TTCGACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt