Transcript: Human NM_001277732.1

Homo sapiens amine oxidase copper containing 3 (AOC3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
AOC3 (8639)
Length:
2412
CDS:
152..814

Additional Resources:

NCBI RefSeq record:
NM_001277732.1
NBCI Gene record:
AOC3 (8639)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001277732.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359543 GCCACCTCCAAGGACTCTAAA pLKO_005 1140 3UTR 100% 13.200 7.920 N AOC3 n/a
2 TRCN0000359612 AGGATGCTTCTGCTCACATTC pLKO_005 1228 3UTR 100% 10.800 6.480 N AOC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001277732.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01977 pDONR223 100% 28.8% 28.8% None 0_1ins1629 n/a
2 ccsbBroad304_01977 pLX_304 0% 28.8% 28.8% V5 0_1ins1629 n/a
3 TRCN0000471128 AAAAGACTATGGGTAATGAGTTCG pLX_317 18.5% 28.8% 28.8% V5 0_1ins1629 n/a
Download CSV