Construct: ORF TRCN0000471146
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006595.1_s317c1
- Derived from:
- ccsbBroadEn_10733
- DNA Barcode:
- TGTAAACCTGCTCGCCGACGTCCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CHRNA1 (1134)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471146
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 1134 | CHRNA1 | cholinergic receptor nicoti... | NM_000079.4 | 57.6% | 55.7% | (many diffs) |
| 2 | human | 1134 | CHRNA1 | cholinergic receptor nicoti... | NM_001039523.3 | 54.6% | 52.9% | (many diffs) |
| 3 | human | 1134 | CHRNA1 | cholinergic receptor nicoti... | XM_017003257.1 | 54.1% | 52.8% | (many diffs) |
| 4 | human | 1134 | CHRNA1 | cholinergic receptor nicoti... | XM_017003256.1 | 51.4% | 50.2% | (many diffs) |
| 5 | mouse | 11435 | Chrna1 | cholinergic receptor, nicot... | NM_007389.5 | 51.7% | 52.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 873
- ORF length:
- 807
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga gccctggcct ctcctcctgc tctttagcct ttgctcagct ggcctcgtcc 121 tgggctccga acatgagacc cgtctggtgg caaagctatt taaagactac agcagcgtgg 181 tgcggccagt ggaagaccac cgccaggtcg tggaggtcac cgtgggcctg cagctgatac 241 agctcatcaa tgtggatgaa gtaaatcaga tcgtgacaac caatgtgcgt ctgaaacagc 301 aatgggtgga ttacaaccta aaatggaatc cagatgacta tggcggtgtg aaaaaaattc 361 acattccttc agaaaagatc tggcgcccag accttgttct ctataacaat gcagatggtg 421 actttgctat tgtcaagttc accaaagtgc tccTGCAGTA CACTGGCCAC ATCACGTGGA 481 CACCTCCAGC CATCTTTAAA AGCTACTGTG AGATCATCGT CACCCACTTT CCCTTTGATG 541 AACAGAACTG CAGCATGAAG CTGGGCACCT GGACCTACGA CGGCTCTGTC GTGGCCATCA 601 ACCCGGAAAG CGACCAGCCA GACCTGAGCA ACTTCATGGA GAGCGGGGAG TGGGTGATCA 661 AGGAGTCCCG GGGCTGGAAG CACTCCGTGA CCTATTCCTG CTGCCCCGAC ACCCCCTACC 721 TGGACATCAC CTACCACTTC GTCATGCAGC GCCTGCCCCT CTACTTCATC GTCAACGTCA 781 TCATCCCCTG CCTGCTCTTC TCCTTCTTAA CTGGCCTGGT ATTCTACCTG CCCACAGACT 841 CAGGTGGGTG TGGTTGCCAT GACTGCTGCT GCTGCCCAAC TTTCTTGTAC AAAGTGGTTG 901 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 961 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGATG 1021 TAAACCTGCT CGCCGACGTC CGACGCGTTA AGTCgacaat caacctctgg attacaaaat 1081 ttgtgaaaga tt