Transcript: Human NM_000079.4

Homo sapiens cholinergic receptor nicotinic alpha 1 subunit (CHRNA1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
CHRNA1 (1134)
Length:
1984
CDS:
79..1452

Additional Resources:

NCBI RefSeq record:
NM_000079.4
NBCI Gene record:
CHRNA1 (1134)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000079.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417628 AGGTCGACTCATTGAATTAAA pLKO_005 1419 CDS 100% 15.000 21.000 N CHRNA1 n/a
2 TRCN0000060990 CGACACTATCCCAAATATCAT pLKO.1 1089 CDS 100% 5.625 7.875 N CHRNA1 n/a
3 TRCN0000060988 CCTTCTTAACTGGCCTGGTAT pLKO.1 815 CDS 100% 4.950 6.930 N CHRNA1 n/a
4 TRCN0000060989 GCCCAGACCTTGTTCTCTATA pLKO.1 398 CDS 100% 13.200 10.560 N CHRNA1 n/a
5 TRCN0000431397 ACATTGATATCTCTGACATTT pLKO_005 1172 CDS 100% 13.200 9.240 N CHRNA1 n/a
6 TRCN0000060992 ACAACCAATGTGCGTCTGAAA pLKO.1 289 CDS 100% 4.950 3.465 N CHRNA1 n/a
7 TRCN0000060991 GCAATGGTGATGGACCACATA pLKO.1 1345 CDS 100% 4.950 3.465 N CHRNA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000079.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10733 pDONR223 100% 57.6% 55.7% None (many diffs) n/a
2 ccsbBroad304_10733 pLX_304 0% 57.6% 55.7% V5 (many diffs) n/a
3 TRCN0000471146 TGTAAACCTGCTCGCCGACGTCCG pLX_317 51.9% 57.6% 55.7% V5 (many diffs) n/a
4 TRCN0000491414 CCAACCCCGCAGAATAAGCCCCGA pLX_317 37.2% 57.6% 55.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV