Construct: ORF TRCN0000471177
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000365.1_s317c1
- Derived from:
- ccsbBroadEn_11854
- DNA Barcode:
- GGACTTAGAGAGGGATAATAATTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TUBGCP4 (27229)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471177
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 27229 | TUBGCP4 | tubulin gamma complex assoc... | XM_011521455.2 | 63.8% | 64% | (many diffs) |
2 | human | 27229 | TUBGCP4 | tubulin gamma complex assoc... | XM_011521454.3 | 53.9% | 54.1% | (many diffs) |
3 | human | 27229 | TUBGCP4 | tubulin gamma complex assoc... | XM_017022078.2 | 53.8% | 53.9% | (many diffs) |
4 | human | 27229 | TUBGCP4 | tubulin gamma complex assoc... | NM_001286414.3 | 50.8% | 50.9% | (many diffs) |
5 | human | 27229 | TUBGCP4 | tubulin gamma complex assoc... | NM_014444.5 | 50.6% | 50.8% | (many diffs) |
6 | human | 27229 | TUBGCP4 | tubulin gamma complex assoc... | XR_243092.4 | 24.2% | 1_687del;1714_4227del | |
7 | human | 27229 | TUBGCP4 | tubulin gamma complex assoc... | XR_001751226.2 | 19.2% | 1_687del;1714_5333del | |
8 | mouse | 51885 | Tubgcp4 | tubulin, gamma complex asso... | NM_153387.3 | 46% | 49.9% | (many diffs) |
9 | mouse | 51885 | Tubgcp4 | tubulin, gamma complex asso... | NM_001290824.1 | 45.8% | 49.7% | (many diffs) |
10 | mouse | 51885 | Tubgcp4 | tubulin, gamma complex asso... | NR_110985.1 | 30.8% | (many diffs) | |
11 | mouse | 51885 | Tubgcp4 | tubulin, gamma complex asso... | NR_077245.2 | 30.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1092
- ORF length:
- 1026
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggt tgtagtagaa caaattaaaa gtcaaaagat tcatggttgt caaatcctgg 121 aaacagtcta caaacacagc tgtggggggt tgcctcctgt tcgaagtgca ctggaaaaaa 181 tcctggccgt ttgtcatggg gtcatgtata aacagctctc agcctggatg ctccatggac 241 tcctcttgga ccagcatgaa gaattcttta tcaaacaggg gccatcttct ggtaatgtca 301 gtgcccagcc agaagaggac gaggaggatc tgggcattgg gggactgaca ggaaaacaac 361 tgagagaact gcaggacttg cgcctgattg aggaagagaa catgctggca ccatctctga 421 agcagttttc cctacgagtg gagattttgc catcctacat tccagtgagg gttgctgaaa 481 aaatcctatt tgttggagaa tctgtccaga tgtttgagaa tcaaaatgtg aacctgacta 541 gaaaaggatc cattttgaaa aaccaggaag acacttttgc tgcagagctg caccgtctca 601 agcagcagcc actcttcagc ttggtggact ttGAACAGGT GGTGGATCGC ATTCGCAGCA 661 CTGTGGCTGA GCATCTCTGG AAGTTGATGG TAGAAGAATC CGATTTACTG GGTCAGCTGA 721 AGATCATTAA AGACTTTTAC CTTCTGGGAC GTGGAGAACT GTTTCAGGCC TTCATTGACA 781 CAGCTCAACA CATGTTGAAA ACACCACCCA CTGCAGTAAC TGAGCATGAT GTGAATGTGG 841 CCTTTCAACA GTCAGCACAC AAGGTATTGC TAGATGATGA CAACCTTCTC CCTCTGTTGC 901 ACTTGACAAT CGAGTATCAC GGAAAGGAGC ACAAAGCAGA TGCTACTCAG GCAAGAGAAG 961 GGCCTTCTCG GGAAACTTCT CCCCGGGAAG CCCCTGCATC TGGCTGGGCA GCCCTAGGTC 1021 TTTCCTACAA AGTACAGTGG CCACTACATA TTCTCTTCAC CCCAGCTGTC CTGGAAAAAA 1081 ATAGACAATT TTACCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1141 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1201 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGAGGA CTTAGAGAGG GATAATAATT 1261 CACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t