Transcript: Mouse NM_153387.3

Mus musculus tubulin, gamma complex associated protein 4 (Tubgcp4), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Tubgcp4 (51885)
Length:
4278
CDS:
227..2230

Additional Resources:

NCBI RefSeq record:
NM_153387.3
NBCI Gene record:
Tubgcp4 (51885)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153387.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120808 CGCCTAATTGAGGAAGAGAAT pLKO.1 950 CDS 100% 4.950 6.930 N Tubgcp4 n/a
2 TRCN0000120811 CTGAGTTCATTGAACAGTATA pLKO.1 393 CDS 100% 13.200 10.560 N Tubgcp4 n/a
3 TRCN0000444411 TCGCCAAGCACTGCTTGATTT pLKO_005 526 CDS 100% 13.200 9.240 N Tubgcp4 n/a
4 TRCN0000430785 TGGGTCAGCTGAAGATCATTA pLKO_005 1278 CDS 100% 13.200 9.240 N Tubgcp4 n/a
5 TRCN0000157865 CCAGTCTTCACTCCTGTTCAA pLKO.1 2089 CDS 100% 4.950 3.465 N TUBGCP4 n/a
6 TRCN0000120809 CCTGTGTTTCACTGCCTGAAT pLKO.1 1958 CDS 100% 4.950 3.465 N Tubgcp4 n/a
7 TRCN0000120810 GCACACAAGGTGTTGCTAGAT pLKO.1 1424 CDS 100% 4.950 3.465 N Tubgcp4 n/a
8 TRCN0000120807 GCCACATTCTGATGTCTGTAA pLKO.1 2265 3UTR 100% 4.950 2.970 N Tubgcp4 n/a
9 TRCN0000156413 CCCTCTGTGATGGTTGTAGTA pLKO.1 626 CDS 100% 4.950 3.465 N TUBGCP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153387.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08072 pDONR223 100% 90.4% 97.9% None (many diffs) n/a
2 ccsbBroad304_08072 pLX_304 0% 90.4% 97.9% V5 (many diffs) n/a
3 TRCN0000473209 TTTTTTTACCTGTTGCTACGCCGG pLX_317 17.3% 90.4% 97.9% V5 (many diffs) n/a
4 ccsbBroadEn_11854 pDONR223 100% 46% 49.9% None (many diffs) n/a
5 ccsbBroad304_11854 pLX_304 0% 46% 49.9% V5 (many diffs) n/a
6 TRCN0000471177 GGACTTAGAGAGGGATAATAATTC pLX_317 44.9% 46% 49.9% V5 (many diffs) n/a
Download CSV