Construct: ORF TRCN0000471234
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009319.1_s317c1
- Derived from:
- ccsbBroadEn_11811
- DNA Barcode:
- ACAAAGACATGGTGGCGGTGCTCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CCDC69 (26112)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471234
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 26112 | CCDC69 | coiled-coil domain containi... | NM_015621.3 | 17.2% | 7.3% | 1_667del;814G>A;888_889ins385 |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 672
- ORF length:
- 606
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag gacctccatg tccgaagccg caaccaggtg gtcctgtcaa ggcagctgtc 121 agaagacctg cttctcacgc gtgaggccct ggagaaggag gtgcagctgc ggcgacagct 181 ccagcaggag aaggaggagc tgttgtaccg gatccttggg gccaatgcct cgcctgcctt 241 ccctctggcc cctgtcactc ccactgaggt ctctttcctc gccacatagg gtgcagggcc 301 tgggcccacc acgacgcctg aagtcacagc tccttccaag gtttttctgg agaagacagc 361 aggagcctct cagttctttt ccaggaagga acgagggtgg gagcgagatg gagatcctgg 421 gtgtgtgccc agtgagccct ggggcctTGA GTTACATGGA ATCACCCACA GGGTTTTGGA 481 GGCCCCGAGA AGCGTCTTCC CTTGAGTTGG CCAAGGGAAT AAGCAAGAGG AGACATTTCC 541 TCCCTGCCCC AGCACTCTGT CCCAATCCGA GAAGTTCCGA GGCTTTCCCG GGGCAGTCTG 601 TGTCACGCTG GCCATTTGAC ATAAAGGAGA CAGCCCCTGG TCCCAGCTTG TCAGCTCTGC 661 TGCCGACTTG CTGCCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 721 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 781 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGAACA AAGACATGGT GGCGGTGCTC 841 TACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t