Transcript: Human NM_015621.3

Homo sapiens coiled-coil domain containing 69 (CCDC69), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
CCDC69 (26112)
Length:
3398
CDS:
123..1013

Additional Resources:

NCBI RefSeq record:
NM_015621.3
NBCI Gene record:
CCDC69 (26112)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015621.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421125 GACTGGTCAAAGGACTCTTAT pLKO_005 1482 3UTR 100% 13.200 10.560 N CCDC69 n/a
2 TRCN0000425596 GTCTCTTTCCTCGCCACATAG pLKO_005 993 CDS 100% 10.800 8.640 N CCDC69 n/a
3 TRCN0000008692 GCCGAAACTATAAGAAACATA pLKO.1 592 CDS 100% 5.625 4.500 N CCDC69 n/a
4 TRCN0000008689 GCCGACTTGCTGACTTATCAA pLKO.1 1387 3UTR 100% 5.625 4.500 N CCDC69 n/a
5 TRCN0000427436 CACGCTGGCCATTTGACATAA pLKO_005 1329 3UTR 100% 13.200 9.240 N CCDC69 n/a
6 TRCN0000008690 CGAGATGAAGAATGAGCGTAT pLKO.1 677 CDS 100% 4.050 2.835 N CCDC69 n/a
7 TRCN0000008693 CAGAAGGATATAACCAGAATT pLKO.1 291 CDS 100% 0.000 0.000 N CCDC69 n/a
8 TRCN0000008691 GCCTCATATGAACAGGAGAAA pLKO.1 450 CDS 100% 0.000 0.000 N CCDC69 n/a
9 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2952 3UTR 100% 4.950 2.475 Y ERAP2 n/a
10 TRCN0000138140 GATTGAGACCATCCTGGCTAA pLKO.1 3007 3UTR 100% 4.050 2.025 Y LOC441087 n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2953 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015621.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11811 pDONR223 100% 17.2% 7.3% None 1_667del;814G>A;888_889ins385 n/a
2 ccsbBroad304_11811 pLX_304 0% 17.2% 7.3% V5 1_667del;814G>A;888_889ins385 n/a
3 TRCN0000471234 ACAAAGACATGGTGGCGGTGCTCT pLX_317 37.5% 17.2% 7.3% V5 1_667del;814G>A;888_889ins385 n/a
Download CSV