Construct: ORF TRCN0000471283
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012783.1_s317c1
- Derived from:
- ccsbBroadEn_06795
- DNA Barcode:
- TGCTCCAAGTCGTATCGACTCTAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PSMA1 (5682)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471283
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5682 | PSMA1 | proteasome 20S subunit alpha 1 | NM_002786.3 | 99.8% | 99.6% | 110G>T |
| 2 | human | 5682 | PSMA1 | proteasome 20S subunit alpha 1 | NM_148976.2 | 97.5% | 97% | 1_18del;20A>T;128G>T |
| 3 | human | 5682 | PSMA1 | proteasome 20S subunit alpha 1 | NM_001143937.1 | 47.1% | 44.4% | (many diffs) |
| 4 | mouse | 26440 | Psma1 | proteasome (prosome, macrop... | NM_011965.2 | 91.8% | 97.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 855
- ORF length:
- 789
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtt tcgaaatcag tatgacaatg atgtcactgt ttggagcccc cagggcagga 121 ttcatcaaat tgaatatgca atggaagctg ttaaacaagg ttcagccaca gttgttctga 181 aatcaaaaac tcatgcagtt ttggttgcat tgaaaagggc gcaatcagag cttgcagctc 241 atcagaaaaa aattctccat gttgacaacc atattggtat ctcaattgcg gggcttactg 301 ctgatgctag actgttatgt aattttatgc gtcaggagtg tttggattcc agatttgtat 361 tcgatagacc actgcctgtg tctcgtcttg tatctctaat tggaagcaag acccagatac 421 caaCACAACG ATATGGCCGG AGACCATATG GTGTTGGTCT CCTTATTGCT GGTTATGATG 481 ATATGGGCCC TCACATTTTC CAAACCTGTC CATCTGCTAA CTATTTTGAC TGCAGAGCCA 541 TGTCCATTGG AGCCCGTTCC CAATCAGCTC GTACTTACTT GGAGAGACAT ATGTCTGAAT 601 TTATGGAGTG TAATTTAAAT GAACTAGTTA AACATGGTCT GCGTGCCTTA AGAGAGACGC 661 TTCCTGCAGA ACAGGACCTG ACTACAAAGA ATGTTTCCAT TGGAATTGTT GGTAAAGACT 721 TGGAGTTTAC AATCTATGAT GATGATGATG TGTCTCCATT CCTGGAAGGT CTTGAAGAAA 781 GACCACAGAG AAAGGCACAG CCTGCTCAAC CTGCTGATGA ACCTGCAGAA AAGGCTGATG 841 AACCAATGGA ACATTACCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 901 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 961 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA TGCTCCAAGT CGTATCGACT 1021 CTATACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt