Transcript: Human NM_148976.2

Homo sapiens proteasome 20S subunit alpha 1 (PSMA1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-30
Taxon:
Homo sapiens (human)
Gene:
PSMA1 (5682)
Length:
1498
CDS:
346..1155

Additional Resources:

NCBI RefSeq record:
NM_148976.2
NBCI Gene record:
PSMA1 (5682)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_148976.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000003873 GTTCCCAATCAGCTCGTACTT pLKO.1 854 CDS 100% 4.950 6.930 N PSMA1 n/a
2 TRCN0000277828 GTTCCCAATCAGCTCGTACTT pLKO_005 854 CDS 100% 4.950 6.930 N PSMA1 n/a
3 TRCN0000003872 CTGCTGATGCTAGACTGTTAT pLKO.1 596 CDS 100% 13.200 9.240 N PSMA1 n/a
4 TRCN0000277829 CTGCTGATGCTAGACTGTTAT pLKO_005 596 CDS 100% 13.200 9.240 N PSMA1 n/a
5 TRCN0000003871 GAAAGGGTCTGTATAATCATT pLKO.1 1346 3UTR 100% 5.625 3.938 N PSMA1 n/a
6 TRCN0000277831 GAAAGGGTCTGTATAATCATT pLKO_005 1346 3UTR 100% 5.625 3.938 N PSMA1 n/a
7 TRCN0000003870 GCAATGGAAGCTGTTAAACAA pLKO.1 436 CDS 100% 5.625 3.938 N PSMA1 n/a
8 TRCN0000277830 GCAATGGAAGCTGTTAAACAA pLKO_005 436 CDS 100% 5.625 3.938 N PSMA1 n/a
9 TRCN0000003874 CCAGATACCAACACAACGATA pLKO.1 711 CDS 100% 4.950 3.465 N PSMA1 n/a
10 TRCN0000277756 CCAGATACCAACACAACGATA pLKO_005 711 CDS 100% 4.950 3.465 N PSMA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_148976.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01307 pDONR223 100% 97.6% 97.3% None 1_18del;20A>T n/a
2 ccsbBroad304_01307 pLX_304 0% 97.6% 97.3% V5 1_18del;20A>T n/a
3 TRCN0000470186 TACGGCGATAGCCATTACACTTCG pLX_317 35.2% 97.6% 97.3% V5 1_18del;20A>T n/a
4 ccsbBroadEn_06795 pDONR223 100% 97.5% 97% None 1_18del;20A>T;128G>T n/a
5 ccsbBroad304_06795 pLX_304 0% 97.5% 97% V5 1_18del;20A>T;128G>T n/a
6 TRCN0000471283 TGCTCCAAGTCGTATCGACTCTAT pLX_317 54.6% 97.5% 97% V5 1_18del;20A>T;128G>T n/a
Download CSV