Construct: ORF TRCN0000471358
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010230.1_s317c1
- Derived from:
- ccsbBroadEn_02031
- DNA Barcode:
- TTCCCCAATCCAAACTTGTGGAGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CCN6 (8838)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471358
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 8838 | CCN6 | cellular communication netw... | NM_003880.3 | 95.1% | 95.1% | 0_1ins54 |
2 | human | 8838 | CCN6 | cellular communication netw... | NM_198239.2 | 95.1% | 95.1% | 0_1ins54 |
3 | human | 8838 | CCN6 | cellular communication netw... | XM_011536220.1 | 95.1% | 95.1% | 0_1ins54 |
4 | human | 8838 | CCN6 | cellular communication netw... | NR_125353.1 | 79.9% | 1_136del;776_839del;1317_1396del | |
5 | human | 8838 | CCN6 | cellular communication netw... | XR_001743705.1 | 63.6% | (many diffs) | |
6 | human | 8838 | CCN6 | cellular communication netw... | NR_125354.2 | 43.2% | (many diffs) | |
7 | human | 8838 | CCN6 | cellular communication netw... | XM_011536223.3 | 43% | 43% | 0_1ins636 |
8 | human | 8838 | CCN6 | cellular communication netw... | XM_011536222.2 | 39.3% | 35.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1185
- ORF length:
- 1116
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gaacaagcgg cgacttctct acccctcagg gtggctccac ggtcccagcg 121 acatgcaggg gctcctcttc tccactcttc tgcttgctgg cctggcacag ttctgctgca 181 gggtacaggg cactggacca ttagatacaa cacctgaagg aaggcctgga gaagtgtcag 241 atgcacctca gcgtaaacag ttttgtcact ggccctgcaa atgccctcag cagaagcccc 301 gttgccctcc tggagtgagc ctggtgagag atggctgtgg atgctgtaaa atctgtgcca 361 agcaaccagg ggaaatctgc aatgaagctg acctctgtga cccacacaaa gggctgtatt 421 gtgactactc agtagacagg cctaggtacg agactggagt gtgtgcatac cttgtagctg 481 ttgggtgcga gttcaaccag gtacattatc ataatggcca agtgtttcag cccaacccct 541 tgttcagctg cctctgtgtg agtggggcca ttggatgcac acctctgttc ataccaaagc 601 tggctggcag tcactgctct ggagctaaag gtggaaagaa gtctgatcag tcaaactgta 661 gcctggaacc attactacag cagctttcaa caagctacaa aacaatgcca gcttatagaa 721 atctcccact tatttggaaa aaaaaatgtc ttgtgcaagc aacaaaatgg actccctgcT 781 CCAGAACATG TGGGATGGGA ATATCTAACA GGGTGACCAA TGAAAACAGC AACTGTGAAA 841 TGAGAAAAGA GAAAAGACTG TGTTACATTC AGCCTTGCGA CAGCAATATA TTAAAGACAA 901 TAAAGATTCC CAAAGGAAAA ACATGCCAAC CTACTTTCCA ACTCTCCAAA GCTGAAAAAT 961 TTGTCTTTTC TGGATGCTCA AGTACTCAGA GTTACAAACC CACTTTTTGT GGAATATGCT 1021 TGGATAAGAG ATGCTGTATC CCTAATAAGT CTAAAATGAT TACTATTCAA TTTGATTGCC 1081 CAAATGAGGG GTCATTTAAA TGGAAGATGC TGTGGATTAC ATCTTGTGTG TGTCAGAGAA 1141 ACTGCAGAGA ACCTGGAGAT ATATTTTCTG AGCTCAAGAT TCTGTTGCCA ACTTTCTTGT 1201 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1261 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1321 GAAAGGACGA TTCCCCAATC CAAACTTGTG GAGAACGCGT TAAGTCgaca atcaacctct 1381 ggattacaaa atttgtgaaa gatt