Transcript: Human XM_011536222.2

PREDICTED: Homo sapiens cellular communication network factor 6 (CCN6), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCN6 (8838)
Length:
1004
CDS:
476..952

Additional Resources:

NCBI RefSeq record:
XM_011536222.2
NBCI Gene record:
CCN6 (8838)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011536222.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000033361 CCATTAGATACAACACCTGAA pLKO.1 614 CDS 100% 4.050 5.670 N CCN6 n/a
2 TRCN0000373896 ATAGAAATCTCCCACTTATTT pLKO_005 984 3UTR 100% 15.000 10.500 N CCN6 n/a
3 TRCN0000373898 CAGATGCACCTCAGCGTAAAC pLKO_005 654 CDS 100% 10.800 7.560 N CCN6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011536222.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02031 pDONR223 100% 39.3% 35.8% None (many diffs) n/a
2 ccsbBroad304_02031 pLX_304 0% 39.3% 35.8% V5 (many diffs) n/a
3 TRCN0000471358 TTCCCCAATCCAAACTTGTGGAGA pLX_317 36.5% 39.3% 35.8% V5 (many diffs) n/a
Download CSV