Construct: ORF TRCN0000471449
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008486.1_s317c1
- Derived from:
- ccsbBroadEn_05892
- DNA Barcode:
- ACTTCGACACCTAAGATTACCTCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- BLK (640)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471449
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 640 | BLK | BLK proto-oncogene, Src fam... | NM_001715.3 | 99.9% | 100% | 330T>C |
| 2 | human | 640 | BLK | BLK proto-oncogene, Src fam... | XM_011543824.1 | 95% | 95.1% | 330T>C;952_1029del |
| 3 | human | 640 | BLK | BLK proto-oncogene, Src fam... | XM_011543825.3 | 95% | 95.1% | 330T>C;952_1029del |
| 4 | human | 640 | BLK | BLK proto-oncogene, Src fam... | NM_001330465.2 | 85.8% | 85.9% | 0_1ins213;117T>C |
| 5 | human | 640 | BLK | BLK proto-oncogene, Src fam... | XM_011543827.1 | 81.6% | 81.7% | 0_1ins213;117T>C;739_816del |
| 6 | human | 640 | BLK | BLK proto-oncogene, Src fam... | XM_011543828.3 | 62.7% | 51.1% | (many diffs) |
| 7 | human | 640 | BLK | BLK proto-oncogene, Src fam... | XM_011543829.3 | 62.5% | 51.2% | (many diffs) |
| 8 | mouse | 12143 | Blk | B lymphoid kinase | NM_007549.2 | 83.9% | 86.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1581
- ORF length:
- 1515
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg gctggtaagt agcaaaaagc cggacaagga aaagccgatc aaagagaagg 121 acaagggcca atggagcccc ctgaaggtca gcgcccaaga caaggacgcc ccgccactgc 181 cgcccctggt tgtcttcaac caccttactc ctccaccgcc cgatgaacac ctggatgaag 241 acaagcattt cgtggtggct ctgtatgact acaccgctat gaatgatcgg gacctgcaga 301 tgctgaaggg ggagaagcta caggtcctga agggaactgg agactggtgg ctggccaggt 361 cactcgtcac aggaagagaa ggctatgtgc ccagcaactt tgtggcccga gtggagagcc 421 tggaaatgga aaggtggttc tttagatcac agggtcggaa ggaggctgag aggcagcttc 481 ttgctccaat caacaaggcc ggctcctttc ttatcagaga gagtgaaacc aacaaaggtg 541 ccttctccct gtctgtgaag gatgtcacca cccaggggga gctgatcaag cactataaga 601 tccgctgcct ggatgaaggg ggctactaca tctccccccg gatcaccttc ccctcgctcc 661 aggccctggt gcagcactat tctaagaagg gggatggtct atgccagagg ctgaccctgc 721 cctgtgtgcg cccggccccg cagaatccct gggcccagga tgaatgggag atcccccggc 781 agtctctcag gctggtcagg aaactcgggt ctggacaatt cggcgaagtc tggatgggtt 841 actacaaaaa caacatgaag gtggccatta agacgctgaa ggagggaacc atgtctccag 901 aagcctttct gggtgaggcc aacgtgatga aggctctgca gcacgagcgg ctggtccgac 961 tctacgcagt ggtcaccaag gagcccatct acattgtcac cgagtacatg gccagaggat 1021 gcctgctgga tttcctgaag acagatgaag ggagcagatt gtcactccca aggctgattg 1081 acatgtcggc gcagattgct gaagggatgg catacattga gcgcatgaat tccatccacc 1141 gcgacctgcg ggcggccaac atcctggtgt ctgaggcctt gtgctgcaaa attgctgatt 1201 ttggcttggc tcgaaTCATC GACAGTGAAT ACACGGCCCA AGAGGGGGCC AAGTTCCCCA 1261 TCAAGTGGAC AGCCCCGGAA GCCATCCACT TCGGGGTCTT CACCATCAAA GCAGACGTGT 1321 GGTCGTTTGG AGTCCTCCTG ATGGAAGTTG TCACTTATGG GCGGGTGCCA TACCCAGGGA 1381 TGAGCAACCC CGAGGTCATC CGCAACCTGG AGCGCGGCTA CCGCATGCCG CGCCCCGACA 1441 CCTGCCCGCC CGAGCTGTAC CGCGGCGTCA TCGCCGAGTG CTGGCGCAGC CGGCCCGAGG 1501 AGCGGCCCAC CTTCGAGTTC CTGCAGTCGG TGCTGGAGGA CTTCTACACG GCCACCGAGC 1561 GGCAGTACGA GCTGCAGCCC TACCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1621 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT TCCGTAACTT 1681 GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGAACT TCGACACCTA 1741 AGATTACCTC TACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat 1801 t