Construct: ORF TRCN0000471500
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009866.1_s317c1
- Derived from:
- ccsbBroadEn_14025
- DNA Barcode:
- AGTTAATATCAAGTCCATCACTCC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- KIAA0513 (9764)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471500
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9764 | KIAA0513 | KIAA0513 | NM_001297766.1 | 99.7% | 1.6% | 13delG;890A>T |
| 2 | human | 9764 | KIAA0513 | KIAA0513 | NM_001286566.1 | 74.8% | 1.2% | 13delG;890A>T;904_1203del |
| 3 | human | 9764 | KIAA0513 | KIAA0513 | NM_001286565.1 | 73% | 1.2% | 13delG;890A>T;904_1233del |
| 4 | human | 9764 | KIAA0513 | KIAA0513 | NM_014732.3 | 73% | 1.2% | 13delG;890A>T;904_1233del |
| 5 | human | 9764 | KIAA0513 | KIAA0513 | XM_005256265.3 | 73% | 1.2% | 13delG;890A>T;904_1233del |
| 6 | human | 9764 | KIAA0513 | KIAA0513 | XM_017023912.1 | 73% | 1.2% | 13delG;890A>T;904_1233del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 96
- ORF length:
- 30
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga gaccccaagg tccccgtggg ctcgctaatc gactttgggc ctgaggcacc 121 cacctcttct cccctggagg caccaccccc tgtgctgcag gacggcgatg gctccctggg 181 ggacggtgca tcagagagtg agaccactga gtctgcggac agtgagaatg acatgggcga 241 gtcgccctcg cacccgtcct gggaccaaga ccgccgttcc tcctccaacg agtccttctc 301 ctccaaccag agcaccgagt ctacccagga tgaagagacc ctggcactca gggacttcat 361 gcgtggctac gtggagaaga tcttctctgg aggggaggac ttggatcagg aggagaaagc 421 caagtttgga gagtactgca gcagtgaaaa tggaaaaggc cgggagtggt ttgctcgata 481 cgtgagtgcc cagcgctgca actccaagtg tgtctcagag gcaaccttct accgcctggt 541 gcagtctttt gcagtggtgc tgttcgagtg tcatcagatg gatgactttg ggcctgccaa 601 gaacctcatg accatgtgct tcacctacta ccacatcgga aaaccacagc tgctgccccc 661 GGAGTCCCGG GAGAAGCCCG CGGGCAGCAT CGACTCCTAC CTGAAATCCG CAAACAGCTG 721 GCTGGCCGAA AAGAAGGACA TCGCCGAGCG GCTGCTGAAG AACACCTCGG CCAGGACTGA 781 GAATGTCAAG GGCTTCTTCG GGGGGCTGGA GACCAAGCTG AAGGGGCCCC TGGCCAGGAG 841 GAACGAGGAA GACGAGAACA AACCCCAGGA GAAGCGGCCC AGGGCTGTGA CCGCGTACAG 901 CCCCGAGGAC GAAAAGAAGG GGGAGAAGAT CTACCTGTAC ACGCACCTGA AGCTACAGCC 961 CATCTGGTAC CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC 1021 TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT 1081 TTCTTGGCTT TATATATCTT GTGGAAAGGA CGAAGTTAAT ATCAAGTCCA TCACTCCACG 1141 CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt