Transcript: Human NM_014732.3

Homo sapiens KIAA0513 (KIAA0513), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-06-30
Taxon:
Homo sapiens (human)
Gene:
KIAA0513 (9764)
Length:
7423
CDS:
274..1509

Additional Resources:

NCBI RefSeq record:
NM_014732.3
NBCI Gene record:
KIAA0513 (9764)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014732.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000450709 GTCCATTGTGAGAGGACAAAG pLKO_005 1216 CDS 100% 10.800 7.560 N KIAA0513 n/a
2 TRCN0000160373 CGTGTATTCATGTTGATGATT pLKO.1 5863 3UTR 100% 5.625 3.938 N KIAA0513 n/a
3 TRCN0000161391 GAAAGCCAAGTTTGGAGAGTA pLKO.1 624 CDS 100% 4.950 3.465 N KIAA0513 n/a
4 TRCN0000137807 GACTTGGATCAGGAGGAGAAA pLKO.1 607 CDS 100% 4.950 3.465 N KIAA0513 n/a
5 TRCN0000136042 GCTGCTCTTTATTCCAGACAA pLKO.1 2418 3UTR 100% 4.950 3.465 N KIAA0513 n/a
6 TRCN0000163230 GCTGTTCGAGTGTCATCAGAT pLKO.1 768 CDS 100% 4.950 3.465 N KIAA0513 n/a
7 TRCN0000135652 GAAGAGCAATACAAGCTGCTT pLKO.1 1456 CDS 100% 2.640 1.848 N KIAA0513 n/a
8 TRCN0000161139 CAAGAAGCTGTGCAATGACTT pLKO.1 1401 CDS 100% 4.950 2.970 N KIAA0513 n/a
9 TRCN0000178177 GAAGAGCAATACAAGCTGCTA pLKO.1 1456 CDS 100% 2.640 1.848 N 6430548M08Rik n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5385 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5385 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014732.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14025 pDONR223 100% 73% 1.2% None 13delG;890A>T;904_1233del n/a
2 ccsbBroad304_14025 pLX_304 0% 73% 1.2% V5 (not translated due to prior stop codon) 13delG;890A>T;904_1233del n/a
3 TRCN0000471500 AGTTAATATCAAGTCCATCACTCC pLX_317 34.4% 73% 1.2% V5 (not translated due to prior stop codon) 13delG;890A>T;904_1233del n/a
Download CSV