Construct: ORF TRCN0000471530
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007159.1_s317c1
- Derived from:
- ccsbBroadEn_02505
- DNA Barcode:
- ATTAATACCCAGACTTTTCGGCAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GNB5 (10681)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471530
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 10681 | GNB5 | G protein subunit beta 5 | NM_006578.4 | 100% | 100% | |
2 | human | 10681 | GNB5 | G protein subunit beta 5 | XM_011521162.3 | 91.9% | 87.7% | (many diffs) |
3 | human | 10681 | GNB5 | G protein subunit beta 5 | NM_016194.4 | 89.3% | 89.3% | 1_126del |
4 | human | 10681 | GNB5 | G protein subunit beta 5 | XM_011521163.3 | 85.2% | 85.2% | 0_1ins156 |
5 | human | 10681 | GNB5 | G protein subunit beta 5 | XM_017021867.2 | 60% | 60% | 0_1ins423 |
6 | human | 10681 | GNB5 | G protein subunit beta 5 | XR_001751060.2 | 46.2% | 1_78del;1138_2292del | |
7 | mouse | 14697 | Gnb5 | guanine nucleotide binding ... | NM_138719.5 | 90.7% | 99.4% | (many diffs) |
8 | mouse | 14697 | Gnb5 | guanine nucleotide binding ... | NM_010313.2 | 81% | 88.8% | (many diffs) |
9 | mouse | 14697 | Gnb5 | guanine nucleotide binding ... | NR_073186.1 | 39.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1125
- ORF length:
- 1059
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc aaccgagggg ctgcacgaga acgagacgct ggcgtcgctg aagagcgagg 121 ccgagagcct caagggcaag ctggaggagg agcgagccaa gctgcacgat gtggagctgc 181 accaggtggc ggagcgggtg gaggccctgg ggcagtttgt catgaagacc agaaggaccc 241 tcaaaggcca cgggaacaaa gtcctgtgca tggactggtg caaagataag aggaggatcg 301 tgagctcgtc acaggatggg aaggtgatcg tgtgggattc cttcaccaca aacaaggagc 361 acgcggtcac catgccctgc acgtgggtga tggcatgtgc ttatgcccca tcgggatgtg 421 ccattgcttg tggtggtttg gataataagt gttctgtgta ccccttgacg tttgacaaaa 481 atgaaaacat ggctgccaaa aagaagtctg ttgctatgca caccaactac ctgtcggcct 541 gcagcttcac caactctgac atgcagatcc tgacagcgag cggcgatggc acatgtgccc 601 tgtgggacgt ggagagcggg cagctgctgc agagcttcca cggacatggg gctgacgtcc 661 tctgcttgga cctggccccc tcagaaactg gaaacacctt cgtgtctggg ggatgtgaca 721 agaaagccat ggtgtgggac atgcgcTCCG GCCAGTGCGT GCAGGCCTTT GAAACACATG 781 AATCTGACAT CAACAGTGTC CGGTACTACC CCAGTGGAGA TGCCTTTGCT TCAGGGTCAG 841 ATGACGCTAC GTGTCGCCTC TATGACCTGC GGGCAGATAG GGAGGTTGCC ATCTATTCCA 901 AAGAAAGCAT CATATTTGGA GCATCCAGCG TGGACTTCTC CCTCAGTGGT CGCCTGCTGT 961 TTGCTGGATA CAATGATTAC ACTATCAACG TCTGGGATGT TCTCAAAGGG TCCCGGGTCT 1021 CCATCCTGTT TGGACATGAA AACCGCGTTA GCACTCTACG AGTTTCCCCC GATGGGACTG 1081 CTTTCTGCTC TGGATCATGG GATCATACCC TCAGAGTCTG GGCCTACCCA ACTTTCTTGT 1141 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1201 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1261 GAAAGGACGA ATTAATACCC AGACTTTTCG GCATACGCGT TAAGTCgaca atcaacctct 1321 ggattacaaa atttgtgaaa gatt