Construct: ORF TRCN0000471567
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016799.1_s317c1
- Derived from:
- ccsbBroadEn_12761
- DNA Barcode:
- ATGCAAACGTCTATAATAAGTCAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TTC29 (83894)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471567
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 83894 | TTC29 | tetratricopeptide repeat do... | XM_011532310.2 | 87.2% | 85.1% | (many diffs) |
| 2 | human | 83894 | TTC29 | tetratricopeptide repeat do... | NM_001317806.2 | 67.1% | 62.9% | (many diffs) |
| 3 | human | 83894 | TTC29 | tetratricopeptide repeat do... | NM_031956.3 | 67% | 62.8% | (many diffs) |
| 4 | human | 83894 | TTC29 | tetratricopeptide repeat do... | XM_006714336.1 | 64.8% | 60.8% | (many diffs) |
| 5 | human | 83894 | TTC29 | tetratricopeptide repeat do... | XM_005263270.1 | 64.7% | 60.7% | (many diffs) |
| 6 | human | 83894 | TTC29 | tetratricopeptide repeat do... | XM_006714335.1 | 63.6% | 59.7% | (many diffs) |
| 7 | human | 83894 | TTC29 | tetratricopeptide repeat do... | NM_001300761.3 | 63.5% | 59.6% | (many diffs) |
| 8 | human | 83894 | TTC29 | tetratricopeptide repeat do... | XM_024454241.1 | 54% | 50.2% | (many diffs) |
| 9 | human | 83894 | TTC29 | tetratricopeptide repeat do... | XR_938777.1 | 52.7% | (many diffs) | |
| 10 | human | 83894 | TTC29 | tetratricopeptide repeat do... | XR_427552.1 | 51.9% | (many diffs) | |
| 11 | human | 83894 | TTC29 | tetratricopeptide repeat do... | XM_006714339.2 | 51.2% | 47.6% | (many diffs) |
| 12 | human | 83894 | TTC29 | tetratricopeptide repeat do... | XR_938778.1 | 47.7% | (many diffs) | |
| 13 | human | 83894 | TTC29 | tetratricopeptide repeat do... | NR_133922.2 | 41.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1023
- ORF length:
- 957
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgac caccctgccc ccactgccca tgacacgccc gaagcttaca gccttagcca 121 gacagaagct gccttgctcc tccagaaaaa ttccaaggtc tcaattgatc aaagaaaaag 181 atgacataga tcattatcta gaggtaaatt tcaaaggatt atcaaaagag gaagttgctg 241 cttataggaa ctcctacaag aagaatatct gtgtggacat gctgcgagat ggttatcata 301 agtccttcac cgagctcttc gctctgatgg agcggtggga tgccctgagg gaggctgcga 361 gagtcaggtc cctcttctgg ctgcagaagc ccctggagga gcagcctgat aaactggatt 421 acctgtacca ttacctgacc agggctgagg acgctgagag gaaagaatcc ttcgaagatg 481 tatataataa cttgtatgct ctggcctgtt acttcaataa ttctgaagac aagtgggtaa 541 ggaaccactt ctatgaacga tgttttaaga ttgctcagct gatcaaaatt gactgtggga 601 agaaagaagc cgaggcacac atgcatatgg gtcttctcta cgaggaagat ggtcagcttc 661 tggaagctgc tgagCATTAT GAAGCATTCC ATCAATTGAC ACAGGGGCGG ATATGGAAGG 721 ATGAGACAGG CCGCTCTCTC AACTTGTTGG CCTGTGAGAG TCTCCTGAGG ACTTACAGAT 781 TACTCTCAGA CAAAATGCTA GAAAATAAAG AATACAAACA GGCCATCAAA ATTCTAATAA 841 AAGCTTCTGA AATAGCCAAA GAAGGAAGTG ACAAAAAGAT GGAAGCGGAA ACCTCTTACT 901 ACTTGGGCTT AGCACACTTA GCTGCTGAGG AATATGAAAC AGCATTAACA GTCCTTGACA 961 CTTACTGTAA ATCTCCACAG ACCTGGATGA TGATCTCAGT CTGGGGAGAG GCTATGAAGC 1021 CATACCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1081 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1141 GGCTTTATAT ATCTTGTGGA AAGGACGAAT GCAAACGTCT ATAATAAGTC AAACGCGTTA 1201 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt