Construct: ORF TRCN0000471600
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010552.1_s317c1
- Derived from:
- ccsbBroadEn_04135
- DNA Barcode:
- AGCACACCGGCTGATAAAATGCAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- KDM8 (79831)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471600
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 79831 | KDM8 | lysine demethylase 8 | NM_024773.3 | 100% | 100% | |
| 2 | human | 79831 | KDM8 | lysine demethylase 8 | XM_017023676.1 | 92.5% | 92.5% | 990_991ins93 |
| 3 | human | 79831 | KDM8 | lysine demethylase 8 | NM_001145348.1 | 91.6% | 91.6% | 1_114del |
| 4 | human | 79831 | KDM8 | lysine demethylase 8 | XM_017023677.2 | 47.8% | 47.8% | 0_1ins651 |
| 5 | human | 79831 | KDM8 | lysine demethylase 8 | XM_017023678.2 | 47.8% | 47.8% | 0_1ins651 |
| 6 | human | 79831 | KDM8 | lysine demethylase 8 | XM_017023679.2 | 47.8% | 47.8% | 0_1ins651 |
| 7 | human | 79831 | KDM8 | lysine demethylase 8 | XR_001751987.1 | 41.4% | 1_31del;959_960ins64;1216_2793del | |
| 8 | human | 79831 | KDM8 | lysine demethylase 8 | XM_017023680.1 | 39.4% | 39.4% | 0_1ins756 |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1314
- ORF length:
- 1248
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc tggagacacc cactgccccg cagagcccct ggccagagaa ggcactttat 121 gggaggccct cagggcgctc ctgccgcaca gtaaagaaga cctgaagttg gacctcgggg 181 agaaagtgga gaggagcgtg gtgacattgt tgcagcgagc cactgagctc ttctacgagg 241 gcaggaggga cgagtgtctg cagagcagcg aggtgatcct ggactactcc tgggagaagc 301 tcaacacggg cacatggcag gacgtagaca aagactggcg ccgggtctac gccatcggct 361 gcctcctgaa agccctgtgt ctgtgccagg cacctgagga tgccaacact gtggccgcag 421 ccctgcgggt ctgtgacatg ggcctgctga tgggggcagc catcctgggg gacatccttc 481 ttaaagtcgc tgccatcctc cagacacacc tccctggaaa gaggcctgcc cgtggctccc 541 tcccagagca accctgcaca aagaaagcaa gggcggacca tggtttgatt ccagatgtga 601 agttagaaaa aacagtcccc cggctgcacc gtccgtccct ccagcatttc agggagcagt 661 ttttggttcc agggaggccc gtgatcctga aaggcgtggc tgaccactgg ccgtgcatgc 721 agaagtggag tttggagtat atccaggaga tcgctggctg ccgaactgtc ccagtggaag 781 ttggttcgag gtacacagat gaggaatggt cccagaccct catgacggtc aacgagttca 841 tcagcaaata catcgtgaat gagccaaggg acgtcgggta ccttgctcag caccagctct 901 ttgaccagat cccggagttg aagcaggaca tcagcatccc cgactactgc agcctgggcg 961 atggggagga ggaggaaatc accatcaatg cctggtttgg TCCCCAGGGA ACCATCTCCC 1021 CACTACATCA GGATCCCCAG CAAAACTTCC TAGTGCAGGT GATGGGGAGG AAGTACATCC 1081 GGCTGTATTC CCCGCAGGAG TCAGGGGCTC TGTACCCTCA TGACACGCAC CTTCTCCATA 1141 ACACGAGCCA GGTTGACGTG GAGAATCCCG ACCTGGAAAA GTTCCCCAAG TTTGCCAAGG 1201 CCCCATTCCT GTCCTGCATC CTGTCTCCTG GAGAGATCCT GTTCATCCCG GTGAAATACT 1261 GGCATTACGT GCGGGCTCTG GATTTGAGCT TCTCGGTCAG CTTCTGGTGG TCGTACCCAA 1321 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 1381 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 1441 TATCTTGTGG AAAGGACGAA GCACACCGGC TGATAAAATG CAGACGCGTT AAGTCgacaa 1501 tcaacctctg gattacaaaa tttgtgaaag att