Transcript: Human NM_024773.3

Homo sapiens lysine demethylase 8 (KDM8), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
KDM8 (79831)
Length:
2431
CDS:
143..1393

Additional Resources:

NCBI RefSeq record:
NM_024773.3
NBCI Gene record:
KDM8 (79831)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024773.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231820 GGAAGTACATCCGGCTGTATT pLKO_005 1146 CDS 100% 13.200 18.480 N KDM8 n/a
2 TRCN0000128906 GCATCAGAAAGCCGAATGTTT pLKO.1 1673 3UTR 100% 5.625 7.875 N KDM8 n/a
3 TRCN0000231823 GGTTGGCTACCTGATTCAAAC pLKO_005 1742 3UTR 100% 10.800 8.640 N KDM8 n/a
4 TRCN0000231822 TTACGTGCGGGCTCTGGATTT pLKO_005 1342 CDS 100% 10.800 8.640 N KDM8 n/a
5 TRCN0000130971 CCTGTTCATCCCGGTGAAATA pLKO.1 1315 CDS 100% 13.200 9.240 N KDM8 n/a
6 TRCN0000231821 TCCTGTTCATCCCGGTGAAAT pLKO_005 1314 CDS 100% 13.200 9.240 N KDM8 n/a
7 TRCN0000231819 TCAGCAAATACATCGTGAATG pLKO_005 918 CDS 100% 10.800 7.560 N KDM8 n/a
8 TRCN0000130438 GAGGAGGAAATCACCATCAAT pLKO.1 1046 CDS 100% 5.625 3.938 N KDM8 n/a
9 TRCN0000129536 CGAGGTACACAGATGAGGAAT pLKO.1 864 CDS 100% 4.950 3.465 N KDM8 n/a
10 TRCN0000130552 GTCAACGAGTTCATCAGCAAA pLKO.1 905 CDS 100% 4.950 3.465 N KDM8 n/a
11 TRCN0000128849 GCACAGTAAAGAAGACCTGAA pLKO.1 223 CDS 100% 4.050 2.835 N KDM8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024773.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04135 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04135 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471600 AGCACACCGGCTGATAAAATGCAG pLX_317 25.5% 100% 100% V5 n/a
Download CSV