Construct: ORF TRCN0000471608
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016180.1_s317c1
- Derived from:
- ccsbBroadEn_06381
- DNA Barcode:
- TGTAATATTACCATGCAATTGTTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- HMGB1 (3146)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471608
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 3146 | HMGB1 | high mobility group box 1 | NM_001313892.1 | 99.6% | 100% | 195A>G;630A>G |
2 | human | 3146 | HMGB1 | high mobility group box 1 | NM_001313893.1 | 99.6% | 100% | 195A>G;630A>G |
3 | human | 3146 | HMGB1 | high mobility group box 1 | NM_001370340.1 | 99.5% | 100% | 195A>G;465T>C;630A>G |
4 | human | 3146 | HMGB1 | high mobility group box 1 | NM_001370341.1 | 99.5% | 100% | 195A>G;465T>C;630A>G |
5 | human | 3146 | HMGB1 | high mobility group box 1 | NM_002128.7 | 99.5% | 100% | 195A>G;465T>C;630A>G |
6 | human | 3146 | HMGB1 | high mobility group box 1 | XM_024449341.1 | 99.5% | 100% | 195A>G;465T>C;630A>G |
7 | human | 3146 | HMGB1 | high mobility group box 1 | NM_001363661.1 | 73% | 73% | (many diffs) |
8 | human | 3146 | HMGB1 | high mobility group box 1 | NM_001370339.1 | 73% | 73% | (many diffs) |
9 | human | 6672 | SP100 | SP100 nuclear antigen | NM_003113.4 | 20.7% | 18.2% | (many diffs) |
10 | mouse | 100862258 | Gm21596 | predicted gene, 21596 | XM_003945339.3 | 91.6% | 99% | (many diffs) |
11 | mouse | 15289 | Hmgb1 | high mobility group box 1 | NM_001313894.1 | 91.4% | 99% | (many diffs) |
12 | mouse | 15289 | Hmgb1 | high mobility group box 1 | NM_010439.4 | 91.4% | 99% | (many diffs) |
13 | mouse | 382421 | Gm5176 | predicted gene 5176; high m... | NR_033603.1 | 72.6% | (many diffs) | |
14 | mouse | 628431 | Hmgb1-rs17 | high mobility group box 1, ... | NR_033589.1 | 37.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 711
- ORF length:
- 645
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg caaaggagat cctaagaagc cgagaggcaa aatgtcatca tatgcatttt 121 ttgtgcaaac ttgtcgggag gagcataaga agaagcaccc agatgcttca gtcaacttct 181 cagagttttc taagaagtgc tcagagaggt ggaagaccat gtctgctaaa gagaaaggaa 241 aatttgaaga tatggcaaag gcggacaagg cccgttatga aagagaaatg aaaacctata 301 tccctcccaa aggggagaca aaaaagaagt tcaaggatcc caatgcaccc aagaggcctc 361 cttcggcctt cttcctcttc tgctctgagt atcgcccaaa aatcaaagga gaacatcctg 421 gcctgtccat tggtgatgtt gcgaagaaac tgggagagat gtggaataac actgctgcag 481 atgacaagca gccTTATGAA AAGAAGGCTG CGAAGCTGAA GGAAAAATAC GAAAAGGATA 541 TTGCTGCATA TCGAGCTAAA GGAAAGCCTG ATGCAGCAAA AAAGGGAGTT GTCAAGGCTG 601 AAAAAAGCAA GAAAAAGAAG GAAGAGGAGG AAGATGAGGA AGATGAAGAG GATGAGGAGG 661 AGGAGGAAGA TGAAGAAGAT GAAGATGAAG AAGAGGATGA TGATGATGAA TACCCAACTT 721 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 781 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 841 CTTGTGGAAA GGACGATGTA ATATTACCAT GCAATTGTTG ACGCGTTAAG TCgacaatca 901 acctctggat tacaaaattt gtgaaagatt