Transcript: Human NM_001370339.1

Homo sapiens high mobility group box 1 (HMGB1), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
HMGB1 (3146)
Length:
5611
CDS:
156..632

Additional Resources:

NCBI RefSeq record:
NM_001370339.1
NBCI Gene record:
HMGB1 (3146)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001370339.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356492 GATGCAGCTTATACGAAATAA pLKO_005 1289 3UTR 100% 15.000 10.500 N HMGB1 n/a
2 TRCN0000347150 GTTGGTGCACAGCACAAATTA pLKO_005 1225 3UTR 100% 15.000 9.000 N Hmgb1-ps7 n/a
3 TRCN0000347067 AGAAGATGATGATGATGAATA pLKO_005 937 3UTR 100% 13.200 7.920 N Hmgb1-ps7 n/a
4 TRCN0000365913 GAAGATGATGATGATGAATAA pLKO_005 938 3UTR 100% 13.200 7.920 N Hmgb1 n/a
5 TRCN0000092693 GCACAGCACAAATTAGTTATA pLKO.1 1231 3UTR 100% 13.200 7.920 N Hmgb1-ps7 n/a
6 TRCN0000374090 TTGGTGCACAGCACAAATTAG pLKO_005 1226 3UTR 100% 13.200 7.920 N Hmgb1 n/a
7 TRCN0000018933 GCAGATGACAAGCAGCCTTAT pLKO.1 567 CDS 100% 10.800 6.480 N HMGB1 n/a
8 TRCN0000356565 TTGGTGATGTTGCGAAGAAAC pLKO_005 520 CDS 100% 10.800 6.480 N HMGB1 n/a
9 TRCN0000018932 CCGTTATGAAAGAGAAATGAA pLKO.1 362 CDS 100% 5.625 3.375 N HMGB1 n/a
10 TRCN0000018934 CCCAGATGCTTCAGTCAACTT pLKO.1 248 CDS 100% 4.950 2.970 N HMGB1 n/a
11 TRCN0000356490 ATTGCTGCATATCGAGCTAAA pLKO_005 785 3UTR 100% 10.800 5.400 Y HMGB1 n/a
12 TRCN0000374091 GGAAGACCATGTCTGCTAAAG pLKO_005 301 CDS 100% 10.800 5.400 Y Hmgb1 n/a
13 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3706 3UTR 100% 4.950 2.475 Y ERAP2 n/a
14 TRCN0000018931 GAAGAAGATGAAGATGAAGAA pLKO.1 917 3UTR 100% 4.950 2.475 Y HMGB1 n/a
15 TRCN0000092696 GAAGATGAAGAAGAAGATGAT pLKO.1 926 3UTR 100% 4.950 2.475 Y Hmgb1-ps7 n/a
16 TRCN0000093082 GAAGATGAAGATGAAGAAGAA pLKO.1 920 3UTR 100% 4.950 2.475 Y Gm5518 n/a
17 TRCN0000093079 GATGAAGAAGAAGATGATGAT pLKO.1 929 3UTR 100% 4.950 2.475 Y Gm5518 n/a
18 TRCN0000138140 GATTGAGACCATCCTGGCTAA pLKO.1 3761 3UTR 100% 4.050 2.025 Y LOC441087 n/a
19 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3707 3UTR 100% 13.200 6.600 Y LIAS n/a
20 TRCN0000063714 GAAGAAGATGATGATGATGAT pLKO.1 935 3UTR 100% 4.950 2.475 Y SET n/a
21 TRCN0000288612 GAAGAAGATGATGATGATGAT pLKO_005 935 3UTR 100% 4.950 2.475 Y SET n/a
22 TRCN0000135549 GAGGAAGATGAAGAGGATGAA pLKO.1 881 3UTR 100% 4.950 2.475 Y GRWD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001370339.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06381 pDONR223 100% 73% 73% None (many diffs) n/a
2 ccsbBroad304_06381 pLX_304 0% 73% 73% V5 (many diffs) n/a
3 TRCN0000471608 TGTAATATTACCATGCAATTGTTG pLX_317 34.2% 73% 73% V5 (many diffs) n/a
4 ccsbBroadEn_14961 pDONR223 60% 72.9% 72% None (many diffs) n/a
5 ccsbBroad304_14961 pLX_304 0% 72.9% 72% V5 (many diffs) n/a
6 TRCN0000472460 CAGTTATAATCGGCCCACAAAGCC pLX_317 60.9% 72% 71.1% V5 (many diffs) n/a
Download CSV