Construct: ORF TRCN0000471705
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002653.1_s317c1
- Derived from:
- ccsbBroadEn_04380
- DNA Barcode:
- AGCATACGCCGTAACACTTTGAAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- HVCN1 (84329)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471705
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 84329 | HVCN1 | hydrogen voltage gated chan... | NM_001040107.2 | 100% | 100% | |
| 2 | human | 84329 | HVCN1 | hydrogen voltage gated chan... | NM_032369.4 | 100% | 100% | |
| 3 | human | 84329 | HVCN1 | hydrogen voltage gated chan... | XM_005253948.2 | 100% | 100% | |
| 4 | human | 84329 | HVCN1 | hydrogen voltage gated chan... | XM_011538845.2 | 100% | 100% | |
| 5 | human | 84329 | HVCN1 | hydrogen voltage gated chan... | XM_011538846.2 | 100% | 100% | |
| 6 | human | 84329 | HVCN1 | hydrogen voltage gated chan... | XM_011538847.1 | 100% | 100% | |
| 7 | human | 84329 | HVCN1 | hydrogen voltage gated chan... | XM_017020027.1 | 100% | 100% | |
| 8 | human | 84329 | HVCN1 | hydrogen voltage gated chan... | XM_024449225.1 | 100% | 100% | |
| 9 | human | 84329 | HVCN1 | hydrogen voltage gated chan... | NM_001256413.2 | 92.6% | 92.6% | 0_1ins60 |
| 10 | human | 84329 | HVCN1 | hydrogen voltage gated chan... | XM_011538838.2 | 85.3% | 85.3% | 20_160del |
| 11 | human | 84329 | HVCN1 | hydrogen voltage gated chan... | XM_011538839.2 | 85.3% | 85.3% | 20_160del |
| 12 | human | 84329 | HVCN1 | hydrogen voltage gated chan... | XM_011538840.3 | 85.3% | 85.3% | 20_160del |
| 13 | human | 84329 | HVCN1 | hydrogen voltage gated chan... | XM_011538841.2 | 85.3% | 85.3% | 20_160del |
| 14 | human | 84329 | HVCN1 | hydrogen voltage gated chan... | XM_011538842.2 | 85.3% | 85.3% | 20_160del |
| 15 | human | 84329 | HVCN1 | hydrogen voltage gated chan... | XM_011538844.2 | 85.3% | 85.3% | 20_160del |
| 16 | human | 84329 | HVCN1 | hydrogen voltage gated chan... | XM_017020026.2 | 85.3% | 85.3% | 20_160del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 885
- ORF length:
- 819
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc cacctgggac gaaaaggcag tcacccgcag ggccaaggtg gctcccgctg 121 agaggatgag caagttctta aggcacttca cggtcgtggg agacgactac catgcctgga 181 acatcaacta caagaaatgg gagaatgaag aggaggagga ggaggaggag cagccaccac 241 ccacaccagt ctcaggcgag gaaggcagag ctgcagcccc tgacgttgcc cctgcccctg 301 gccccgcacc cagggccccc cttgacttca ggggcatgtt gaggaaactg ttcagctccc 361 acaggtttca ggtcatcatc atctgcttgg tggttctgga tgccctcctg gtgcttgctg 421 agctcatcct ggacctgaag atcatccagc ccgacaagaa taactatgct gccatggtat 481 tccactacat gagcatcacc atcttggtct tttttatgat ggagatcatc tttaaattat 541 ttgtcttccg cctggagttc tttcaccaca agtttgagat cctggatgcc gtcgtggtgg 601 tggtctcatt caTCCTCGAC ATTGTCCTCC TGTTCCAGGA GCACCAGTTT GAGGCTCTGG 661 GCCTGCTGAT TCTGCTCCGG CTGTGGCGGG TGGCCCGGAT CATCAATGGG ATTATCATCT 721 CAGTTAAGAC ACGTTCAGAA CGGCAACTCT TAAGGTTAAA ACAGATGAAT GTACAATTGG 781 CCGCCAAGAT TCAACACCTT GAGTTCAGCT GCTCTGAGAA GGAACAAGAA ATTGAAAGAC 841 TTAACAAACT ATTGCGACAG CATGGACTTC TTGGTGAAGT GAACTACCCA ACTTTCTTGT 901 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 961 AGTAATGAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAA 1021 GCATACGCCG TAACACTTTG AACACGCGTT AAGTCgacaa tcaacctctg gattacaaaa 1081 tttgtgaaag att