Transcript: Human XM_017020026.2

PREDICTED: Homo sapiens hydrogen voltage gated channel 1 (HVCN1), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HVCN1 (84329)
Length:
1766
CDS:
173..1135

Additional Resources:

NCBI RefSeq record:
XM_017020026.2
NBCI Gene record:
HVCN1 (84329)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020026.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000165789 CCCGGATCATCAATGGGATTA pLKO.1 942 CDS 100% 10.800 15.120 N HVCN1 n/a
2 TRCN0000162565 CAGCCCGACAAGAATAACTAT pLKO.1 695 CDS 100% 5.625 7.875 N HVCN1 n/a
3 TRCN0000165728 CGTTCAGAACGGCAACTCTTA pLKO.1 980 CDS 100% 4.950 6.930 N HVCN1 n/a
4 TRCN0000432092 GTGAGAGGTTTGGTTTGATAC pLKO_005 1224 3UTR 100% 10.800 8.640 N HVCN1 n/a
5 TRCN0000162585 CCGGATCATCAATGGGATTAT pLKO.1 943 CDS 100% 13.200 9.240 N HVCN1 n/a
6 TRCN0000421377 TGGACAATTGCTAGTTGTATA pLKO_005 1408 3UTR 100% 13.200 9.240 N HVCN1 n/a
7 TRCN0000428229 ACAGGTTTCAGGTCATCATCA pLKO_005 609 CDS 100% 4.950 3.465 N HVCN1 n/a
8 TRCN0000174043 CCACAGGTTTCAGGTCATCAT pLKO.1 607 CDS 100% 4.950 3.465 N Hvcn1 n/a
9 TRCN0000161897 GTCTCATTCATCCTCGACATT pLKO.1 851 CDS 100% 4.950 3.465 N HVCN1 n/a
10 TRCN0000161821 CACAAGTTTGAGATCCTGGAT pLKO.1 815 CDS 100% 2.640 1.848 N HVCN1 n/a
11 TRCN0000414375 TTCTCATGTTGAACACTTTAG pLKO_005 1361 3UTR 100% 10.800 6.480 N HVCN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020026.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04380 pDONR223 100% 85.3% 85.3% None 20_160del n/a
2 ccsbBroad304_04380 pLX_304 0% 85.3% 85.3% V5 20_160del n/a
3 TRCN0000471705 AGCATACGCCGTAACACTTTGAAC pLX_317 33.7% 85.3% 85.3% V5 20_160del n/a
4 TRCN0000491726 ACCTATGCCGTGATTTCATACGTT pLX_317 36.6% 85.3% 85.3% V5 (not translated due to prior stop codon) 20_160del n/a
5 ccsbBroadEn_12812 pDONR223 100% 73.7% 73.7% None 20_160del;335_445del n/a
6 ccsbBroad304_12812 pLX_304 0% 73.7% 73.7% V5 20_160del;335_445del n/a
7 TRCN0000469735 GCCCCATTATATTTTGGCTTGTTC pLX_317 42.3% 73.7% 73.7% V5 20_160del;335_445del n/a
Download CSV