Construct: ORF TRCN0000471781
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009242.1_s317c1
- Derived from:
- ccsbBroadEn_01033
- DNA Barcode:
- ACAAAAATCTTCTACAGTAAAGCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MPV17 (4358)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471781
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4358 | MPV17 | mitochondrial inner membran... | NM_002437.5 | 100% | 100% | |
| 2 | human | 4358 | MPV17 | mitochondrial inner membran... | XM_005264326.4 | 100% | 100% | |
| 3 | human | 4358 | MPV17 | mitochondrial inner membran... | XM_017004150.1 | 93.4% | 87.7% | (many diffs) |
| 4 | human | 4358 | MPV17 | mitochondrial inner membran... | XM_006712021.3 | 89.9% | 87.5% | (many diffs) |
| 5 | human | 4358 | MPV17 | mitochondrial inner membran... | XM_017004151.1 | 89.9% | 87.5% | (many diffs) |
| 6 | human | 4358 | MPV17 | mitochondrial inner membran... | XM_024452913.1 | 89.9% | 87.5% | (many diffs) |
| 7 | human | 4358 | MPV17 | mitochondrial inner membran... | XM_017004152.1 | 69.8% | 69.8% | 0_1ins159 |
| 8 | mouse | 17527 | Mpv17 | MpV17 mitochondrial inner m... | NM_001294324.1 | 89.7% | 92% | (many diffs) |
| 9 | mouse | 17527 | Mpv17 | MpV17 mitochondrial inner m... | NM_001310527.1 | 89.7% | 92% | (many diffs) |
| 10 | mouse | 17527 | Mpv17 | MpV17 mitochondrial inner m... | NM_008622.6 | 89.7% | 92% | (many diffs) |
| 11 | mouse | 17527 | Mpv17 | MpV17 mitochondrial inner m... | NM_001310528.1 | 88.7% | 91% | (many diffs) |
| 12 | mouse | 17527 | Mpv17 | MpV17 mitochondrial inner m... | NM_001294322.1 | 84% | 85.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 594
- ORF length:
- 528
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc actctggcgg gcataccagc gggccctggc cgctcacccg tggaaagtac 121 aggtcctgac agctgggtcc ctgatgggcc tgggtgacat tatctcacag cagctggtgg 181 agaggcgggg tctgcaggaa caccagagag gccggactct gaccatggtg tccctgggct 241 gtggctttgt gggccctgtg gtaggaggct ggtacaaggt tttggatcgg ttcatccctg 301 gcaccaccaa agtggatgca ctgaagaaga tgttgttgga tcaggggggc tttgccccgt 361 gttttctagg ctgctttctc ccactggtag gggcacttaa tggactgtca gcccaggaca 421 actgggccaa actacagcgg gattatcctg atgcccttat caccaactac tatctatggc 481 ctgctgtgca gttagccaac ttctacctgg tcccccttca ttacaggttg gccgttgtcc 541 aatgtgttgc tgttatctgg aactcctacc tgtcctggaa ggcacatcgg ctcTACCCAA 601 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 661 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 721 TATCTTGTGG AAAGGACGAA CAAAAATCTT CTACAGTAAA GCCACGCGTT AAGTCgacaa 781 tcaacctctg gattacaaaa tttgtgaaag att