Transcript: Human XM_017004150.1

PREDICTED: Homo sapiens mitochondrial inner membrane protein MPV17 (MPV17), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MPV17 (4358)
Length:
4236
CDS:
3304..3816

Additional Resources:

NCBI RefSeq record:
XM_017004150.1
NBCI Gene record:
MPV17 (4358)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004150.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127649 CCAATGTGTTGCTGTTATCTG pLKO.1 3759 CDS 100% 4.950 3.960 N MPV17 n/a
2 TRCN0000281038 CCAATGTGTTGCTGTTATCTG pLKO_005 3759 CDS 100% 4.950 3.960 N MPV17 n/a
3 TRCN0000129921 GAGCCCTTGATAATAGTCTTA pLKO.1 3995 3UTR 100% 4.950 3.960 N MPV17 n/a
4 TRCN0000281040 GAGCCCTTGATAATAGTCTTA pLKO_005 3995 3UTR 100% 4.950 3.960 N MPV17 n/a
5 TRCN0000128669 CTGAAGAAGATGTTGTTGGAT pLKO.1 3541 CDS 100% 3.000 2.100 N MPV17 n/a
6 TRCN0000281106 CTGAAGAAGATGTTGTTGGAT pLKO_005 3541 CDS 100% 3.000 2.100 N MPV17 n/a
7 TRCN0000131201 GCAGTTAGCCAACTTCTACCT pLKO.1 3708 CDS 100% 2.640 1.848 N MPV17 n/a
8 TRCN0000281039 GCAGTTAGCCAACTTCTACCT pLKO_005 3708 CDS 100% 2.640 1.848 N MPV17 n/a
9 TRCN0000131038 CTTCATTACAGGTTGGCCGTT pLKO.1 3736 CDS 100% 2.160 1.512 N MPV17 n/a
10 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 790 5UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004150.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01033 pDONR223 100% 93.4% 87.7% None (many diffs) n/a
2 ccsbBroad304_01033 pLX_304 0% 93.4% 87.7% V5 (many diffs) n/a
3 TRCN0000471781 ACAAAAATCTTCTACAGTAAAGCC pLX_317 2% 93.4% 87.7% V5 (many diffs) n/a
Download CSV