Construct: ORF TRCN0000471851
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005215.1_s317c1
- Derived from:
- ccsbBroadEn_03535
- DNA Barcode:
- CCACGGGCCAATTAGCTGCAATTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ZDHHC4 (55146)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471851
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 55146 | ZDHHC4 | zinc finger DHHC-type conta... | NM_001134387.1 | 100% | 100% | |
2 | human | 55146 | ZDHHC4 | zinc finger DHHC-type conta... | NM_001134388.1 | 100% | 100% | |
3 | human | 55146 | ZDHHC4 | zinc finger DHHC-type conta... | NM_001134389.2 | 100% | 100% | |
4 | human | 55146 | ZDHHC4 | zinc finger DHHC-type conta... | NM_001371293.1 | 100% | 100% | |
5 | human | 55146 | ZDHHC4 | zinc finger DHHC-type conta... | NM_001371294.1 | 100% | 100% | |
6 | human | 55146 | ZDHHC4 | zinc finger DHHC-type conta... | NM_001371295.1 | 100% | 100% | |
7 | human | 55146 | ZDHHC4 | zinc finger DHHC-type conta... | NM_001371296.1 | 100% | 100% | |
8 | human | 55146 | ZDHHC4 | zinc finger DHHC-type conta... | NM_001371297.1 | 100% | 100% | |
9 | human | 55146 | ZDHHC4 | zinc finger DHHC-type conta... | NM_018106.4 | 100% | 100% | |
10 | human | 55146 | ZDHHC4 | zinc finger DHHC-type conta... | XM_005249796.3 | 100% | 100% | |
11 | human | 55146 | ZDHHC4 | zinc finger DHHC-type conta... | NM_001371292.1 | 95.8% | 95.8% | 497_541del |
12 | human | 55146 | ZDHHC4 | zinc finger DHHC-type conta... | NM_001371298.1 | 90% | 86.7% | (many diffs) |
13 | human | 55146 | ZDHHC4 | zinc finger DHHC-type conta... | XM_011515442.2 | 90% | 86.7% | (many diffs) |
14 | human | 55146 | ZDHHC4 | zinc finger DHHC-type conta... | XM_017012391.1 | 90% | 86.7% | (many diffs) |
15 | human | 55146 | ZDHHC4 | zinc finger DHHC-type conta... | NM_001371299.1 | 76.4% | 71.5% | (many diffs) |
16 | human | 55146 | ZDHHC4 | zinc finger DHHC-type conta... | NR_163913.1 | 67.1% | 1_233del;730_842del;1379_1537del | |
17 | human | 55146 | ZDHHC4 | zinc finger DHHC-type conta... | NR_163912.1 | 58.8% | 1_207del;704_1060del;1597_1755del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1098
- ORF length:
- 1032
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga ctttctggtc ctcttcttgt tctacctggc ttcggtgctg atgggtcttg 121 ttcttatctg cgtctgctcg aaaacccata gcttgaaagg cctggccagg ggaggagcac 181 agatattttc ctgtataatt ccagaatgtc ttcagagagc cgtgcatgga ttgcttcatt 241 accttttcca tacgagaaac cacaccttca ttgtcctgca cctggtcttg caagggatgg 301 tttatactga gtacacctgg gaagtatttg gctactgtca ggagctggag ttgtccttgc 361 attaccttct tctgccctat ctgctgctag gtgtaaacct gttttttttc accctgactt 421 gtggaaccaa tcctggcatt ataacaaaag caaatgaatt attatttctt catgtttatg 481 aatttgatga agtgatgttt ccaaagaacg tgaggtgctc tacttgtgat ttaaggaaac 541 cagctcgatc caagcactgc agtgtgtgta actggtgtgt gcaccgtttc gaccatcact 601 gtgtttgggt gaacaactgc atcggggcct ggaacatcag gtacttccTC ATCTACGTCT 661 TGACCTTGAC GGCCTCGGCT GCCACCGTCG CCATTGTGAG CACCACTTTT CTGGTCCACT 721 TGGTGGTGAT GTCAGATTTA TACCAGGAGA CTTACATCGA TGACCTTGGA CACCTCCATG 781 TTATGGACAC GGTCTTTCTT ATTCAGTACC TGTTCCTGAC TTTTCCACGG ATTGTCTTCA 841 TGCTGGGCTT TGTCGTGGTT CTGAGCTTCC TCCTGGGTGG CTACCTGTTG TTTGTCCTGT 901 ATCTGGCGGC CACCAACCAG ACTACTAACG AGTGGTACAG AGGTGACTGG GCCTGGTGCC 961 AGCGTTGTCC CCTTGTGGCC TGGCCTCCGT CAGCAGAGCC CCAAGTCCAC CGGAACATTC 1021 ACTCCCATGG GCTTCGGAGC AACCTTCAAG AGATCTTTCT ACCTGCCTTT CCATGTCATG 1081 AGAGGAAGAA ACAAGAATGC CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 1141 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 1201 GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA CGACCACGGG CCAATTAGCT 1261 GCAATTGACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt