Transcript: Human XM_017012391.1

PREDICTED: Homo sapiens zinc finger DHHC-type containing 4 (ZDHHC4), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZDHHC4 (55146)
Length:
1364
CDS:
304..1278

Additional Resources:

NCBI RefSeq record:
XM_017012391.1
NBCI Gene record:
ZDHHC4 (55146)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012391.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000138339 CCGTGCATGGATTGCTTCATT pLKO.1 398 CDS 100% 5.625 7.875 N ZDHHC4 n/a
2 TRCN0000281222 CCGTGCATGGATTGCTTCATT pLKO_005 398 CDS 100% 5.625 7.875 N ZDHHC4 n/a
3 TRCN0000138475 CGTTTCGACCATCACTGTGTT pLKO.1 763 CDS 100% 4.950 3.960 N ZDHHC4 n/a
4 TRCN0000281223 CGTTTCGACCATCACTGTGTT pLKO_005 763 CDS 100% 4.950 3.960 N ZDHHC4 n/a
5 TRCN0000136066 GAGGTGCTCTACTTGTGATTT pLKO.1 690 CDS 100% 13.200 9.240 N ZDHHC4 n/a
6 TRCN0000281221 GAGGTGCTCTACTTGTGATTT pLKO_005 690 CDS 100% 13.200 9.240 N ZDHHC4 n/a
7 TRCN0000138940 GACTGCCTTTGAGCTGTAGTT pLKO.1 1288 3UTR 100% 4.950 3.465 N ZDHHC4 n/a
8 TRCN0000135968 GAGATCTTTCTACCTGCCTTT pLKO.1 1228 CDS 100% 4.050 2.835 N ZDHHC4 n/a
9 TRCN0000281150 GAGATCTTTCTACCTGCCTTT pLKO_005 1228 CDS 100% 4.050 2.835 N ZDHHC4 n/a
10 TRCN0000134249 CATGGATTGCTTCATTACCTT pLKO.1 403 CDS 100% 3.000 2.100 N ZDHHC4 n/a
11 TRCN0000134624 GCTCTACTTGTGATTTAAGGA pLKO.1 695 CDS 100% 3.000 2.100 N ZDHHC4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012391.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03535 pDONR223 100% 90% 86.7% None (many diffs) n/a
2 ccsbBroad304_03535 pLX_304 0% 90% 86.7% V5 (many diffs) n/a
3 TRCN0000471851 CCACGGGCCAATTAGCTGCAATTG pLX_317 43.7% 90% 86.7% V5 (many diffs) n/a
Download CSV