Construct: ORF TRCN0000471987
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013698.2_s317c1
- Derived from:
- ccsbBroadEn_05701
- DNA Barcode:
- CACAGATGCACTAACCCGGCGGCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CKMT1A (548596)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471987
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 548596 | CKMT1A | creatine kinase, mitochondr... | NM_001015001.2 | 100% | 100% | |
| 2 | human | 548596 | CKMT1A | creatine kinase, mitochondr... | NM_001321926.1 | 100% | 100% | |
| 3 | human | 1159 | CKMT1B | creatine kinase, mitochondr... | NM_020990.4 | 99.8% | 100% | 1056A>G;1086T>C |
| 4 | human | 1159 | CKMT1B | creatine kinase, mitochondr... | XM_011521197.2 | 99.8% | 100% | 1056A>G;1086T>C |
| 5 | human | 548596 | CKMT1A | creatine kinase, mitochondr... | NM_001321927.1 | 93% | 93% | 148_240del |
| 6 | human | 548596 | CKMT1A | creatine kinase, mitochondr... | NM_001321928.1 | 93% | 93% | 148_240del |
| 7 | human | 548596 | CKMT1A | creatine kinase, mitochondr... | XM_017022369.1 | 93% | 93% | 148_240del |
| 8 | human | 548596 | CKMT1A | creatine kinase, mitochondr... | XM_017022370.1 | 93% | 93% | 148_240del |
| 9 | human | 1159 | CKMT1B | creatine kinase, mitochondr... | XM_011521194.1 | 92.9% | 93% | 148_240del;1149A>G;1179T>C |
| 10 | human | 1159 | CKMT1B | creatine kinase, mitochondr... | XM_011521195.2 | 92.9% | 93% | 148_240del;1149A>G;1179T>C |
| 11 | human | 1159 | CKMT1B | creatine kinase, mitochondr... | XM_011521196.1 | 92.9% | 93% | 148_240del;1149A>G;1179T>C |
| 12 | human | 1159 | CKMT1B | creatine kinase, mitochondr... | XM_011521198.1 | 88.7% | 88.7% | (many diffs) |
| 13 | human | 548596 | CKMT1A | creatine kinase, mitochondr... | NM_001321929.1 | 61.8% | 60.9% | 0_1ins433;11_12ins44 |
| 14 | human | 548596 | CKMT1A | creatine kinase, mitochondr... | XM_005254498.4 | 61.8% | 60.9% | 0_1ins433;11_12ins44 |
| 15 | human | 1159 | CKMT1B | creatine kinase, mitochondr... | XM_005254150.4 | 61.7% | 60.9% | (many diffs) |
| 16 | human | 1159 | CKMT1B | creatine kinase, mitochondr... | XM_011521199.2 | 61.7% | 60.9% | (many diffs) |
| 17 | human | 1159 | CKMT1B | creatine kinase, mitochondr... | XM_017021902.1 | 61.7% | 60.9% | (many diffs) |
| 18 | human | 548596 | CKMT1A | creatine kinase, mitochondr... | NR_135856.1 | 59.5% | (many diffs) | |
| 19 | human | 1159 | CKMT1B | creatine kinase, mitochondr... | NR_135751.1 | 46.2% | (many diffs) | |
| 20 | human | 1159 | CKMT1B | creatine kinase, mitochondr... | NR_135750.1 | 44.4% | (many diffs) | |
| 21 | human | 1159 | CKMT1B | creatine kinase, mitochondr... | NR_135748.1 | 43.7% | (many diffs) | |
| 22 | human | 1159 | CKMT1B | creatine kinase, mitochondr... | NR_135749.1 | 41.8% | (many diffs) | |
| 23 | human | 548596 | CKMT1A | creatine kinase, mitochondr... | XM_017022371.1 | 41.2% | 34.5% | 148_240del;537_538ins44;648_649ins652 |
| 24 | mouse | 12716 | Ckmt1 | creatine kinase, mitochondr... | NM_001355069.1 | 92.2% | 96.6% | (many diffs) |
| 25 | mouse | 12716 | Ckmt1 | creatine kinase, mitochondr... | NM_009897.3 | 92.2% | 96.6% | (many diffs) |
| 26 | mouse | 12716 | Ckmt1 | creatine kinase, mitochondr... | XM_006498656.3 | 92.2% | 96.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1317
- ORF length:
- 1251
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc tggtcccttc tcccgtctgc tgtccgcccg cccgggactc aggctcctgg 121 ctttggccgg agcggggtct ctagccgctg ggtttctgct ccgaccggaa cctgtacgag 181 ctgccagtga acgacggagg ctgtatcccc cgagcgctga gtacccagac ctccgaaagc 241 acaacaactg catggccagt cacctgaccc cagcagtcta tgcacggctc tgcgacaaga 301 ccacacccac tggttggacg ctagatcagt gtatccagac tggcgtggac aaccctggcc 361 accccttcat caagactgtg ggcatggtgg ctggagatga ggagacctat gaggtatttg 421 ctgacctgtt tgaccctgtg atccaagagc gacacaatgg atatgacccc cggacaatga 481 agcacaccac ggatctagat gccagtaaaa tccgttctgg ctactttgat gagaggtatg 541 tattgtcctc tagagtcaga actggccgaa gcatccgagg actcagtctg cctccagctt 601 gcactcgagc agagcgacga gaggtggaac gtgttgtggt ggatgcactg agtggcctga 661 agggtgacct ggctggacgt tactataggc tcagtgagat gacagaggct gaacagcagc 721 agcttattga tgaccacttt ctgtttgata agcctgtgtc cccgttgctg actgcagcag 781 gaatggctcg agactggcca gatgctcgtg gaatttggca caacaatgag aagagcttcc 841 tgatctgggt gaatgaggag gatcatacac gggtgatctc catggagaag ggtggtaaca 901 tgaagagagt gtttgaaaga ttctgccgag gccTCAAAGA GGTGGAGAGA CTTATCCAAG 961 AACGTGGCTG GGAGTTCATG TGGAATGAGC GTTTGGGATA CATCTTGACC TGTCCATCTA 1021 ACCTGGGCAC TGGACTTCGG GCAGGAGTGC ACATCAAACT GCCCCTGCTA AGCAAAGATA 1081 GCCGCTTCCC AAAGATCCTG GAGAACCTAA GACTCCAAAA GCGTGGTACT GGAGGAGTGG 1141 ACACTGCTGC CACAGGCGGT GTCTTTGATA TTTCTAATTT GGACCGACTA GGCAAATCAG 1201 AGGTGGAGCT GGTGCAACTG GTCATCGATG GAGTAAACTA TTTGATTGAT TGTGAACGGC 1261 GTCTGGAGAG AGGCCAGGAT ATCCGCATCC CCACACCTGT CATCCACACC AAGCATTACC 1321 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 1381 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 1441 ATATATCTTG TGGAAAGGAC GACACAGATG CACTAACCCG GCGGCAACGC GTTAAGTCga 1501 caatcaacct ctggattaca aaatttgtga aagatt