Transcript: Human NR_135751.1

Homo sapiens creatine kinase, mitochondrial 1B (CKMT1B), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2019-02-06
Taxon:
Homo sapiens (human)
Gene:
CKMT1B (1159)
Length:
2698
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_135751.1
NBCI Gene record:
CKMT1B (1159)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_135751.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220076 ACCTGGCTGGACGTTACTATA pLKO.1 1080 3UTR 100% 13.200 6.600 Y CKMT1A n/a
2 TRCN0000243701 ACGGATCTAGATGCCAGTAAA pLKO_005 902 3UTR 100% 13.200 6.600 Y CKMT1A n/a
3 TRCN0000243702 AGGCGGTGTCTTTGATATTTC pLKO_005 2384 3UTR 100% 13.200 6.600 Y CKMT1A n/a
4 TRCN0000243704 CATCGATGGAGTAAACTATTT pLKO_005 2453 3UTR 100% 13.200 6.600 Y CKMT1A n/a
5 TRCN0000180608 GCTGAACAGCAGCAGCTTATT pLKO.1 1121 3UTR 100% 13.200 6.600 Y CKMT1A n/a
6 TRCN0000220656 GCTGAACAGCAGCAGCTTATT pLKO.1 1121 3UTR 100% 13.200 6.600 Y CKMT1B n/a
7 TRCN0000220077 GGCCAGATGCTCGTGGAATTT pLKO.1 1209 3UTR 100% 13.200 6.600 Y CKMT1A n/a
8 TRCN0000196397 GACCACTTTCTGTTTGATAAG pLKO.1 1145 3UTR 100% 10.800 5.400 Y CKMT2 n/a
9 TRCN0000243700 GGTGAATGAGGAGGATCATAC pLKO_005 1261 3UTR 100% 10.800 5.400 Y CKMT1A n/a
10 TRCN0000243703 TGAGGAGACCTATGAGGTATT pLKO_005 811 3UTR 100% 10.800 5.400 Y CKMT1A n/a
11 TRCN0000220655 CGGTGTCTTTGATATTTCTAA pLKO.1 2387 3UTR 100% 5.625 2.813 Y CKMT1B n/a
12 TRCN0000220654 CGTGGAATTTGGCACAACAAT pLKO.1 1220 3UTR 100% 5.625 2.813 Y CKMT1B n/a
13 TRCN0000196923 GAGCGACACAATGGATATGAC pLKO.1 860 3UTR 100% 4.950 2.475 Y CKMT1B n/a
14 TRCN0000197251 GAGCGTTTGGGATACATCTTG pLKO.1 2217 3UTR 100% 4.950 2.475 Y CKMT1B n/a
15 TRCN0000220657 GTGATCCAAGAGCGACACAAT pLKO.1 851 3UTR 100% 4.950 2.475 Y CKMT1B n/a
16 TRCN0000195676 CGAAAGCACAACAACTGCATG pLKO.1 647 3UTR 100% 4.050 2.025 Y CKMT1B n/a
17 TRCN0000179459 GCAGCTTATTGATGACCACTT pLKO.1 1132 3UTR 100% 4.050 2.025 Y CKMT1A n/a
18 TRCN0000024926 CCGAAAGCACAACAACTGCAT pLKO.1 646 3UTR 100% 2.640 1.320 Y Ckmt1 n/a
19 TRCN0000181051 CCGAAAGCACAACAACTGCAT pLKO.1 646 3UTR 100% 2.640 1.320 Y CKMT1A n/a
20 TRCN0000197252 GATTGATTGTGAACGGCGTCT pLKO.1 2474 3UTR 100% 2.160 1.080 Y CKMT1B n/a
21 TRCN0000220658 GCTAAGCAAAGATAGCCGCTT pLKO.1 2297 3UTR 100% 2.160 1.080 Y CKMT1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_135751.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00314 pDONR223 100% 46.3% None (many diffs) n/a
2 ccsbBroad304_00314 pLX_304 0% 46.3% V5 (many diffs) n/a
3 TRCN0000473448 TAGCCCCGACCAGACGGTTAACAC pLX_317 38.2% 46.3% V5 (many diffs) n/a
4 ccsbBroadEn_05701 pDONR223 100% 46.2% None (many diffs) n/a
5 ccsbBroad304_05701 pLX_304 0% 46.2% V5 (many diffs) n/a
6 TRCN0000471987 CACAGATGCACTAACCCGGCGGCA pLX_317 30.9% 46.2% V5 (many diffs) n/a
7 ccsbBroadEn_15331 pDONR223 0% 46.2% None (many diffs) n/a
8 ccsbBroad304_15331 pLX_304 0% 46.2% V5 (many diffs) n/a
9 TRCN0000475004 CCAGTAAAACGGTGTAACTTCAAA pLX_317 37.8% 46.2% V5 (many diffs) n/a
10 TRCN0000488041 AATCCCTCTTGATCACATCACAAC pLX_317 26.3% 46.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV