Construct: ORF TRCN0000472063
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018854.1_s317c1
- Derived from:
- ccsbBroadEn_15298
- DNA Barcode:
- ACCCGTATCCCTCTCTAATAACGT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- NEK8 (284086)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472063
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 284086 | NEK8 | NIMA related kinase 8 | NM_178170.3 | 88.7% | 75.5% | (many diffs) |
2 | mouse | 140859 | Nek8 | NIMA (never in mitosis gene... | NM_080849.3 | 77.8% | 71.9% | (many diffs) |
3 | mouse | 140859 | Nek8 | NIMA (never in mitosis gene... | XM_006532184.3 | 77.7% | 72% | (many diffs) |
4 | mouse | 140859 | Nek8 | NIMA (never in mitosis gene... | XM_006532183.3 | 76.7% | 71.5% | (many diffs) |
5 | mouse | 140859 | Nek8 | NIMA (never in mitosis gene... | XM_006532185.3 | 71.4% | 65.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1689
- ORF length:
- 1620
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggagaagtac gagcggatcc gagtggtggg gagaggtgcc ttcgggattg 121 tgcacctgtg cctgcgaaag gctgaccaga agctggtgat catcaagcag attccagtgg 181 aacagatgac caaggaagag cggcaggcag cccagaatga gtgccaggtc ctcaagctgc 241 tcaaccaccc caatgtcatt gagtactacg agaacttcct ggaagacaaa gcccttatga 301 tcgccatgga atatgcacca ggcggcactc tggctgagtt catccaaaag cgctgtaatt 361 ccctgctgga ggaggagacc atcctgcact tcttcgtgca gatcctgctt gcactgcatc 421 atgtgcacac ccacctcatc ctgcaccgag acctcaagac ccagaacatc ctgcttgaca 481 aacaccgcat ggtcgtcaag atcggtgatt tcggcatctc caagatcctt agcagcaaga 541 gcaaggccta cacggtggtg ggtaccccat gctatatctc ccctgagctg tgtgagggca 601 agccctacaa ccagaagagt gacatctggg ccctgggctg tgtcctctac gagctggcca 661 gcctcaagag ggctttcgag gctgcgaact tgccagcact ggtgctgaag atcatgagtg 721 gcacctttgc acctatctct gaccggtaca gccctgagct tcgccagctg gtcctgagtc 781 tactcagcct ggagcctgcc cagcggccac cactcagcca catcatggca cagcccctct 841 gcatccgtgc cctcctcaac ctccacaccg acgtgggcag tgtccgcatg cggagggcag 901 agaagtccgt ggcccccagc aacacaggga gcaggaccac cagtgtccgc tgcagaggta 961 tcccccgggg acctgtgagg ccagccatcc caccaccact gtcgtcagtg tatgcctggg 1021 gtggtgggct gggcaccccc ctgcggctgc caatgctcaa cacagaggtg gtccaggtgg 1081 cagctgggcg cacgcagaaa gccggcgtca cgcgctctgg gcgtctcatc ctgtgggagg 1141 ccccacccct aggtgcaggc ggaggcagtc tccttcctgg ggcagtggag cagccacagc 1201 cccagttcat ctcgcgtttc ctggagggcc agtcgggtgt gaccatcaag cacgtggcct 1261 gtggggactt cttcactgcc tgcctgactg acagaggcat catcatgaca ttcggcagcg 1321 gcagcaatgg gtgcctaggc catggcagcc tcactgacat cagccagccc accattgtgg 1381 aggctttgct gggctatgaa atggtgcagg tggcctgtgg ggcctctcac gtgctggccc 1441 tgtccactga gcgagaacta tttgcctggg gccgtggaga cagcggcaga ctggggctag 1501 gcaccaggga gtcccacagc tgcccccagc aggtgcccat gcccccagga caggaagctc 1561 agcgagttgt atgtggtatc gattcctcca tgatcctcac tgtgcctggc caagccctag 1621 cctgtgggag aaacatccca gtcccgacga tgcaacacga ctggccagta ttaagcctgg 1681 gccccaaata atgattttat tttgactgat agtgacctgt tcgttgcaac aaattgatga 1741 gcaatgcttt tttataatgc caactttgta ctatgatttt attttgactg atannnannt 1801 nnncnncatg gctttttgcc cgccgtggct tnnaacaaat tgatgagcaa tgctttttta 1861 taatgccaac tttgtacaaa aaagttggca ccatggcttt ttgcccgccg tggctttttc 1921 cccccgccgc cgcggctttt tgtgggtttg tttttttttg ccgccgcggc tttttgcccc 1981 gccTCAGCTG CTGTGACTGC CTCGGGTGAT TGCTACACTT TTGGCAGCAA TCAGCACGGA 2041 CAGTTGGGCA CCAATACTCG CCGAGGCAGT CGGGCACCCT GTAAGGTCCA AGGCCTTGAG 2101 GGCATCAAGA TGGCAATGGT AGCCTGTGGG GATGCCTTCA CTGTAGCTAT TGGGGCAGAG 2161 AGCGAAGTGT ACTCTTGGGG CAAAGGGGCG CGAGGTCGAT TGGGAAGGAG GGATGAGGAT 2221 GCCGGACTCC CTCGGCCAGT GCAGTTGGAT GAGACACACC CTTACACGGT GACTTCCGTG 2281 TCCTGTTGCC ATGGAAACAC CCTCCTGGCT GTTCGATCGG TCACAGATGA GCCGGTCCCC 2341 CCCTTGCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC 2401 CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT 2461 TGGCTTTATA TATCTTGTGG AAAGGACGAA CCCGTATCCC TCTCTAATAA CGTACGCGTT 2521 AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag att