Construct: ORF TRCN0000472077
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017979.1_s317c1
- Derived from:
- ccsbBroadEn_05417
- DNA Barcode:
- TGGTCATGTGGGCGGGGAACGCCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- P2RY8 (286530)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472077
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 286530 | P2RY8 | P2Y receptor family member 8 | NM_178129.5 | 100% | 100% | |
2 | human | 286530 | P2RY8 | P2Y receptor family member 8 | XM_005274429.3 | 100% | 100% | |
3 | human | 286530 | P2RY8 | P2Y receptor family member 8 | XM_005274778.3 | 100% | 100% | |
4 | human | 286530 | P2RY8 | P2Y receptor family member 8 | XM_011545631.2 | 100% | 100% | |
5 | human | 286530 | P2RY8 | P2Y receptor family member 8 | XM_011545632.2 | 100% | 100% | |
6 | human | 286530 | P2RY8 | P2Y receptor family member 8 | XM_011546178.2 | 100% | 100% | |
7 | human | 286530 | P2RY8 | P2Y receptor family member 8 | XM_011546179.2 | 100% | 100% | |
8 | human | 286530 | P2RY8 | P2Y receptor family member 8 | XM_006724443.3 | 65.5% | 65.5% | 1_567del |
9 | human | 286530 | P2RY8 | P2Y receptor family member 8 | XM_006724864.3 | 65.5% | 65.5% | 1_567del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1143
- ORF length:
- 1077
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgca ggtcccgaac agcaccggcc cggacaacgc gacgctgcag atgctgcgga 121 acccggcgat cgcggtggcc ctgcccgtgg tgtactcgct ggtggcggcg gtcagcatcc 181 cgggcaacct cttctctctg tgggtgctgt gccggcgcat ggggcccaga tccccgtcgg 241 tcatcttcat gatcaacctg agcgtcacgg acctgatgct ggccagcgtg ttgcctttcc 301 aaatctacta ccattgcaac cgccaccact gggtattcgg ggtgctgctt tgcaacgtgg 361 tgaccgtggc cttttacgca aacatgtatt ccagcatcct caccatgacc tgtatcagcg 421 tggagcgctt cctgggggtc ctgtacccgc tcagctccaa gcgctggcgc cgccgtcgtt 481 acgcggtggc cgcgtgtgca gggacctggc tgctgctcct gaccgccctg tccccgctgg 541 cgcgcaccga tctcacctac ccggtgcacg ccctgggcat catcacctgc ttcgacgtcc 601 tcaagtggac gatgctcccc agcgtggcca tgtgggccgt gttcctcttc accatcttca 661 tcctgctgtt cctcatcccg ttcgtgatca ccgtggcttg ttacacggcc accatcctca 721 agctgttgcg cacggaggag gcgcacggcc ggGAGCAGCG GAGGCGCGCG GTGGGCCTGG 781 CCGCGGTGGT CTTGCTGGCC TTTGTCACCT GCTTCGCCCC CAACAACTTC GTGCTCCTGG 841 CGCACATCGT GAGCCGCCTG TTCTACGGCA AGAGCTACTA CCACGTGTAC AAGCTCACGC 901 TGTGTCTCAG CTGCCTCAAC AACTGTCTGG ACCCGTTTGT TTATTACTTT GCGTCCCGGG 961 AATTCCAGCT GCGCCTGCGG GAATATTTGG GCTGCCGCCG GGTGCCCAGA GACACCCTGG 1021 ACACGCGCCG CGAGAGCCTC TTCTCCGCCA GGACCACGTC CGTGCGCTCC GAGGCCGGTG 1081 CGCACCCTGA AGGGATGGAG GGAGCCACCA GGCCCGGCCT CCAGAGGCAG GAGAGTGTGT 1141 TCTGCCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1201 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1261 GGCTTTATAT ATCTTGTGGA AAGGACGATG GTCATGTGGG CGGGGAACGC CTACGCGTTA 1321 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt