Construct: ORF TRCN0000472109
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017976.1_s317c1
- Derived from:
- ccsbBroadEn_06992
- DNA Barcode:
- TAACCCCTCCATGAGAGGGTGTGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SRC (6714)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472109
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 6714 | SRC | SRC proto-oncogene, non-rec... | NM_005417.4 | 100% | 100% | |
| 2 | human | 6714 | SRC | SRC proto-oncogene, non-rec... | NM_198291.2 | 100% | 100% | |
| 3 | human | 6714 | SRC | SRC proto-oncogene, non-rec... | XM_011529013.2 | 99.9% | 100% | 1218G>C |
| 4 | human | 6714 | SRC | SRC proto-oncogene, non-rec... | XM_017028024.1 | 98.8% | 98.8% | 351_368del;1236G>C |
| 5 | human | 6714 | SRC | SRC proto-oncogene, non-rec... | XM_017028025.1 | 98.8% | 98.8% | 351_368del;1236G>C |
| 6 | human | 6714 | SRC | SRC proto-oncogene, non-rec... | XM_017028026.1 | 98.8% | 98.8% | 351_368del;1236G>C |
| 7 | human | 6714 | SRC | SRC proto-oncogene, non-rec... | XM_017028027.2 | 98.8% | 98.8% | 351_368del;1236G>C |
| 8 | mouse | 20779 | Src | Rous sarcoma oncogene | NM_001025395.2 | 90% | 98.8% | (many diffs) |
| 9 | mouse | 20779 | Src | Rous sarcoma oncogene | NM_009271.3 | 89% | 97.7% | (many diffs) |
| 10 | mouse | 20779 | Src | Rous sarcoma oncogene | XM_006499063.3 | 87.3% | 95.8% | (many diffs) |
| 11 | mouse | 20779 | Src | Rous sarcoma oncogene | XM_006499065.3 | 87.3% | 95.8% | (many diffs) |
| 12 | mouse | 20779 | Src | Rous sarcoma oncogene | XM_006499066.2 | 87.3% | 95.8% | (many diffs) |
| 13 | mouse | 20779 | Src | Rous sarcoma oncogene | XM_011239402.2 | 87.3% | 95.8% | (many diffs) |
| 14 | mouse | 20779 | Src | Rous sarcoma oncogene | XM_011239403.2 | 87.3% | 95.8% | (many diffs) |
| 15 | mouse | 20779 | Src | Rous sarcoma oncogene | XM_011239404.1 | 87.3% | 95.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1674
- ORF length:
- 1608
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg tagcaacaag agcaagccca aggatgccag ccagcggcgc cgcagcctgg 121 agcccgccga gaacgtgcac ggcgctggcg ggggcgcttt ccccgcctcg cagaccccca 181 gcaagccagc ctcggccgac ggccaccgcg gccccagcgc ggccttcgcc cccgcggccg 241 ccgagcccaa gctgttcgga ggcttcaact cctcggacac cgtcacctcc ccgcagaggg 301 cgggcccgct ggccggtgga gtgaccacct ttgtggccct ctatgactat gagtctagga 361 cggagacaga cctgtccttc aagaaaggcg agcggctcca gattgtcaac aacacagagg 421 gagactggtg gctggcccac tcgctcagca caggacagac aggctacatc cccagcaact 481 acgtggcgcc ctccgactcc atccaggctg aggagtggta ttttggcaag atcaccagac 541 gggagtcaga gcggttactg ctcaatgcag agaacccgag agggaccttc ctcgtgcgag 601 aaagtgagac cacgaaaggt gcctactgcc tctcagtgtc tgacttcgac aacgccaagg 661 gcctcaacgt gaagcactac aagatccgca agctggacag cggcggcttc tacatcacct 721 cccgcaccca gttcaacagc ctgcagcagc tggtggccta ctactccaaa cacgccgatg 781 gcctgtgcca ccgcctcacc accgtgtgcc ccacgtccaa gccgcagact cagggcctgg 841 ccaaggatgc ctgggagatc cctcgggagt cgctgcggct ggaggtcaag ctgggccagg 901 gctgctttgg cgaggtgtgg atggggacct ggaacggtac caccagggtg gccatcaaaa 961 ccctgaagcc tggcacgatg tctccagagg ccttcctgca ggaggcccag gtcatgaaga 1021 agctgaggca tgagaagctg gtgcagttgt atgctgtggt ttcagaggag cccatttaca 1081 tcgtcacgga gtacatgagc aaggggagtt tgctggactt tctcaagggg gagacaggca 1141 agtacctgcg gctgcctcag ctggtggaca tggctgctca gatcgccTCA GGCATGGCGT 1201 ACGTGGAGCG GATGAACTAC GTCCACCGGG ACCTTCGTGC AGCCAACATC CTGGTGGGAG 1261 AGAACCTGGT GTGCAAAGTG GCCGACTTTG GGCTGGCTCG GCTCATTGAA GACAATGAGT 1321 ACACGGCGCG GCAAGGTGCC AAATTCCCCA TCAAGTGGAC GGCTCCAGAA GCTGCCCTCT 1381 ATGGCCGCTT CACCATCAAG TCGGACGTGT GGTCCTTCGG GATCCTGCTG ACTGAGCTCA 1441 CCACAAAGGG ACGGGTGCCC TACCCTGGGA TGGTGAACCG CGAGGTGCTG GACCAGGTGG 1501 AGCGGGGCTA CCGGATGCCC TGCCCGCCGG AGTGTCCCGA GTCCCTGCAC GACCTCATGT 1561 GCCAGTGCTG GCGGAAGGAG CCTGAGGAGC GGCCCACCTT CGAGTACCTG CAGGCCTTCC 1621 TGGAGGACTA CTTCACGTCC ACCGAGCCCC AGTACCAGCC CGGGGAGAAC CTCTACCCAA 1681 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 1741 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 1801 TATCTTGTGG AAAGGACGAT AACCCCTCCA TGAGAGGGTG TGCACGCGTT AAGTCgacaa 1861 tcaacctctg gattacaaaa tttgtgaaag att