Construct: ORF TRCN0000472195
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009937.1_s317c1
- Derived from:
- ccsbBroadEn_03191
- DNA Barcode:
- GCAGTGAAACCGAGTGTTCCCTGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NOSIP (51070)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472195
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51070 | NOSIP | nitric oxide synthase inter... | NM_001270960.2 | 100% | 100% | |
| 2 | human | 51070 | NOSIP | nitric oxide synthase inter... | NM_015953.4 | 100% | 100% | |
| 3 | human | 51070 | NOSIP | nitric oxide synthase inter... | XM_017026851.1 | 100% | 100% | |
| 4 | human | 51070 | NOSIP | nitric oxide synthase inter... | XM_017026852.1 | 100% | 100% | |
| 5 | human | 51070 | NOSIP | nitric oxide synthase inter... | XM_011527017.2 | 99.6% | 99.6% | 1_3delATG |
| 6 | human | 51070 | NOSIP | nitric oxide synthase inter... | NM_001363649.1 | 99% | 99% | 416_424delCAGGTGACT |
| 7 | human | 51070 | NOSIP | nitric oxide synthase inter... | XM_005258964.5 | 99% | 99% | 416_424delCAGGTGACT |
| 8 | human | 51070 | NOSIP | nitric oxide synthase inter... | XM_011527015.2 | 98.6% | 98.6% | 1_3delATG;419_427delCAGGTGACT |
| 9 | human | 51070 | NOSIP | nitric oxide synthase inter... | XM_024451529.1 | 86.7% | 86.7% | 537_674del |
| 10 | human | 51070 | NOSIP | nitric oxide synthase inter... | XM_024451530.1 | 86.7% | 86.7% | 537_674del |
| 11 | human | 51070 | NOSIP | nitric oxide synthase inter... | XM_024451528.1 | 86.4% | 86.4% | 1_3delATG;540_677del |
| 12 | mouse | 66394 | Nosip | nitric oxide synthase inter... | NM_025533.3 | 85.6% | 90.6% | (many diffs) |
| 13 | mouse | 66394 | Nosip | nitric oxide synthase inter... | XM_017312232.1 | 85.6% | 90.6% | (many diffs) |
| 14 | mouse | 66394 | Nosip | nitric oxide synthase inter... | XM_006541078.2 | 79.6% | 84.1% | (many diffs) |
| 15 | mouse | 66394 | Nosip | nitric oxide synthase inter... | NM_001163684.1 | 78.2% | 83.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 969
- ORF length:
- 903
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgac gcggcatggc aagaactgca ccgcaggggc cgtctacacc taccacgaga 121 agaagaagga cacagcggcc tcgggctatg ggacccagaa cattcgactg agccgggatg 181 ccgtgaagga cttcgactgc tgttgtctct ccctgcagcc ttgccacgat cctgttgtca 241 ccccagatgg ctacctgtat gagcgtgagg ccatcctgga gtacattctg caccagaaga 301 aggagattgc ccggcagatg aaggcctacg agaagcagcg gggcacccgg cgcgaggagc 361 agaaggagct tcagcgggcg gcctcgcagg accatgtgcg gggcttcctg gagaaggagt 421 cggctatcgt gagccggccc ctcaaccctt tcacagccaa ggccctctcg ggcaccagcc 481 cagatgatgt ccaacctggg cccagtgtgg gTCCTCCAAG TAAGGACAAG GACAAAGTGC 541 TGCCCAGCTT CTGGATCCCG TCGCTGACGC CCGAAGCCAA GGCCACCAAG CTGGAGAAGC 601 CGTCCCGCAC GGTGACCTGC CCCATGTCAG GGAAGCCCCT GCGCATGTCG GACCTGACGC 661 CCGTGCACTT CACACCGCTA GACAGCTCCG TGGACCGCGT GGGGCTCATC ACCCGCAGCG 721 AGCGCTACGT GTGTGCCGTG ACCCGCGACA GCCTGAGCAA CGCCACCCCC TGCGCTGTGC 781 TGCGGCCCTC TGGGGCTGTG GTCACCCTCG AATGCGTGGA GAAGCTGATT CGGAAGGACA 841 TGGTGGACCC TGTGACTGGA GACAAACTCA CAGACCGCGA CATCATCGTG CTGCAGCGGG 901 GCGGTACCGG CTTCGCGGGC TCCGGAGTGA AGCTGCAAGC GGAGAAATCA CGGCCGGTGA 961 TGCAGGCCTG CCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 1021 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1081 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGAGCAGTG AAACCGAGTG TTCCCTGCAC 1141 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt