Transcript: Human XM_017026852.1

PREDICTED: Homo sapiens nitric oxide synthase interacting protein (NOSIP), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NOSIP (51070)
Length:
1080
CDS:
135..1040

Additional Resources:

NCBI RefSeq record:
XM_017026852.1
NBCI Gene record:
NOSIP (51070)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017026852.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045603 CCAAGTAAGGACAAGGACAAA pLKO.1 585 CDS 100% 4.950 3.465 N NOSIP n/a
2 TRCN0000075836 CTACACCTACCACGAGAAGAA pLKO.1 173 CDS 100% 4.950 3.465 N Nosip n/a
3 TRCN0000045606 CGTCTACACCTACCACGAGAA pLKO.1 170 CDS 100% 4.050 2.835 N NOSIP n/a
4 TRCN0000045605 GAAGCTGATTCGGAAGGACAT pLKO.1 890 CDS 100% 4.050 2.835 N NOSIP n/a
5 TRCN0000045607 TGAAGGACTTCGACTGCTGTT pLKO.1 253 CDS 100% 4.050 2.835 N NOSIP n/a
6 TRCN0000045604 CTGCACCAGAAGAAGGAGATT pLKO.1 357 CDS 100% 4.950 2.970 N NOSIP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017026852.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03191 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03191 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472195 GCAGTGAAACCGAGTGTTCCCTGC pLX_317 50.7% 100% 100% V5 n/a
4 ccsbBroadEn_08209 pDONR223 100% 99.8% 99.6% None 503C>T n/a
5 ccsbBroad304_08209 pLX_304 0% 99.8% 99.6% V5 503C>T n/a
6 TRCN0000479992 TCGAACATTGCCAACAGCTTGAGT pLX_317 46.6% 99.8% 99.6% V5 503C>T n/a
Download CSV