Construct: ORF TRCN0000472273
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017243.1_s317c1
- Derived from:
- ccsbBroadEn_01611
- DNA Barcode:
- TCTTAATTTAGGTTACTGTGTTAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- STAT6 (6778)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472273
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 6778 | STAT6 | signal transducer and activ... | NM_001178078.2 | 100% | 100% | |
| 2 | human | 6778 | STAT6 | signal transducer and activ... | NM_001178079.2 | 100% | 100% | |
| 3 | human | 6778 | STAT6 | signal transducer and activ... | NM_003153.5 | 100% | 100% | |
| 4 | human | 6778 | STAT6 | signal transducer and activ... | XM_011538703.3 | 97.9% | 97.9% | 1511_1564del |
| 5 | human | 6778 | STAT6 | signal transducer and activ... | XM_011538704.3 | 97.9% | 97.9% | 1511_1564del |
| 6 | human | 6778 | STAT6 | signal transducer and activ... | XM_011538705.3 | 97.9% | 97.9% | 1511_1564del |
| 7 | human | 6778 | STAT6 | signal transducer and activ... | XM_011538707.3 | 97.9% | 97.9% | 1511_1564del |
| 8 | human | 6778 | STAT6 | signal transducer and activ... | NM_001178080.2 | 87% | 87% | 0_1ins330 |
| 9 | human | 6778 | STAT6 | signal transducer and activ... | NM_001178081.2 | 87% | 87% | 0_1ins330 |
| 10 | human | 6778 | STAT6 | signal transducer and activ... | XM_011538708.3 | 85.2% | 85.2% | 0_1ins330;1181_1234del |
| 11 | human | 6778 | STAT6 | signal transducer and activ... | NR_033659.2 | 60.6% | 1_255del;370_371ins139;2658_3824del | |
| 12 | mouse | 20852 | Stat6 | signal transducer and activ... | NM_009284.2 | 85% | 85.6% | (many diffs) |
| 13 | mouse | 20852 | Stat6 | signal transducer and activ... | XR_001779497.1 | 58.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2607
- ORF length:
- 2541
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc tctgtggggt ctggtctcca agatgccccc agaaaaagtg cagcggctct 121 atgtcgactt tccccaacac ctgcggcatc ttctgggtga ctggctggag agccagccct 181 gggagttcct ggtcggctcc gacgccttct gctgcaactt ggctagtgcc ctactttcag 241 acactgtcca gcaccttcag gcctcggtgg gagagcaggg ggaggggagc accatcttgc 301 aacacatcag cacccttgag agcatatatc agagggaccc cctgaagctg gtggccactt 361 tcagacaaat acttcaagga gagaaaaaag ctgttatgga acagttccgc cacttgccaa 421 tgcctttcca ctggaagcag gaagaactca agtttaagac aggcttgcgg aggctgcagc 481 accgagtagg ggagatccac cttctccgag aagccctgca gaagggggct gaggctggcc 541 aagtgtctct gcacagcttg atagaaactc ctgctaatgg gactgggcca agtgaggccc 601 tggccatgct actgcaggag accactggag agctagaggc agccaaagcc ctagtgctga 661 agaggatcca gatttggaaa cggcagcagc agctggcagg gaatggcgca ccgtttgagg 721 agagcctggc cccactccag gagaggtgtg aaagcctggt ggacatttat tcccagctac 781 agcaggaggt aggggcggct ggtggggagc ttgagcccaa gacccgggca tcgctgactg 841 gccggctgga tgaagtcctg agaaccctcg tcaccagttg cttcctggtg gagaagcagc 901 ccccccaggt actgaagact cagaccaagt tccaggctgg agttcgattc ctgttgggct 961 tgaggttcct gggggcccca gccaagcctc cgctggtcag ggccgacatg gtgacagaga 1021 agcaggcgcg ggagctgagt gtgcctcagg gtcctggggc tggagcagaa agcactggag 1081 aaatcatcaa caacactgtg cccttggaga acagcattcc tgggaactgc tgctctgccc 1141 tgttcaagaa cctgcttctc aagaagatca agcggtgtga gcggaagggc actgagtctg 1201 tcacagagga gaagtgcgct gtgctcttct ctgccagctt cacacttggc cccggcaaac 1261 tccccatcca gctccaggcc ctgtctctgc ccctggtggt catcgtccat ggcaaccaag 1321 acaacaatgc caaagccact atcctgtggg acaatgcctt ctctgagatg gaccgcgtgc 1381 cctttgtggt ggctgagcgg gtgccctggg agaagatgtg tgaaactctg aacctgaagt 1441 tcatggctga ggtggggacc aaccgggggc tgctcccaga gcacttcctc ttcctggccc 1501 agaagatctt caatgacaac agcctcagta tggaggcctt ccagcaccgt tctgtgtcct 1561 ggtcgcagtt caacaaggag atcctgctgg gccgtggctt caccttttgg cagtggtttg 1621 atggtgtcct ggacctcacc aaacgctgtc tccggagcta ctggtctgac cggctgatca 1681 ttggcttcat cagcaaacag tacgttacta gccttcttct caatgagccc gacggaacct 1741 ttctcctccg cttcagcgac tcagagattg ggggcatcac cattgcccat gtcatccggg 1801 gccaggatgg ctctccacag atagagaaca tccagccatt ctctgccaaa gacctgtcca 1861 ttcgctcact gggggaccga atccgggatc ttgctcagct caaaaatctc tatcccaaga 1921 agcccaagga tgaggctttc cggagccact acaagcctga acagatgggt aaggatggca 1981 ggggttatgt cccagctacc atcaagatga ccgtggaaag ggaccaacca cttcctaccc 2041 cagagctcca gatgcctacc atggtgcctt cttatgacct tggaatggcc cctgattcct 2101 ccatgagcat gcagcttggc ccagatatgg tgccccaggt gtacccacca cactctcact 2161 ccatcccccc gtatcaaggc ctctccccag aagaatcagt caacgtgttg tcagccttcc 2221 aggagcctca cctgcagatg ccccccagcc tgggccagat gagcctgccc tttgaccagc 2281 ctcaccccca gggcctgctg ccgtgccagc ctcaggagca tgctgtgtcc agccctgacc 2341 ccctgctctg ctcagatgtg accatggtgg aagacagctg cctgagccag ccagtgacag 2401 cgtttcctca gggcacttgg attggtgaag acatattccc tcctctgctg cctcccactg 2461 aacaggacct cactaagctt ctcctggagg ggcaagggga gtcgggggga gggtccttgg 2521 gggcacagcc cctcctgcag ccctcccact atgggcaatc TGGGATCTCA ATGTCCCACA 2581 TGGACCTAAG GGCCAACCCC AGTTGGTGCC CAACTTTCTT GTACAAAGTG GTTGATATCG 2641 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 2701 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GATCTTAATT 2761 TAGGTTACTG TGTTAAACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 2821 aagatt