Transcript: Human XM_011538707.3

PREDICTED: Homo sapiens signal transducer and activator of transcription 6 (STAT6), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STAT6 (6778)
Length:
4014
CDS:
287..2884

Additional Resources:

NCBI RefSeq record:
XM_011538707.3
NBCI Gene record:
STAT6 (6778)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011538707.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000274154 AGCGGCTCTATGTCGACTTTC pLKO_005 333 CDS 100% 10.800 15.120 N STAT6 n/a
2 TRCN0000019411 GCTTGATAGAAACTCCTGCTA pLKO.1 777 CDS 100% 2.640 3.696 N STAT6 n/a
3 TRCN0000019410 GCCTTCTTATGACCTTGGAAT pLKO.1 2341 CDS 100% 4.950 3.960 N STAT6 n/a
4 TRCN0000274155 AGCACCCTTGAGAGCATATAT pLKO_005 530 CDS 100% 15.000 10.500 N STAT6 n/a
5 TRCN0000218520 AGCAGGAAGAACTCAAGTTTA pLKO_005 657 CDS 100% 13.200 9.240 N Stat6 n/a
6 TRCN0000019412 GCCACTTTCAGACAAATACTT pLKO.1 575 CDS 100% 5.625 3.938 N STAT6 n/a
7 TRCN0000274156 GCCACTTTCAGACAAATACTT pLKO_005 575 CDS 100% 5.625 3.938 N STAT6 n/a
8 TRCN0000019409 GCAGGAACATACAGACACATT pLKO.1 3300 3UTR 100% 4.950 3.465 N STAT6 n/a
9 TRCN0000274209 GCAGGAACATACAGACACATT pLKO_005 3300 3UTR 100% 4.950 3.465 N STAT6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011538707.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01611 pDONR223 100% 97.9% 97.9% None 1511_1564del n/a
2 TRCN0000472273 TCTTAATTTAGGTTACTGTGTTAA pLX_317 2.2% 97.9% 97.9% V5 1511_1564del n/a
3 ccsbBroad304_01611 pLX_304 22.5% 84.9% 80.4% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000488187 TAGTGACAGGCCACATTACTATGT pLX_317 12% 97.9% 97.9% V5 (not translated due to prior stop codon) 1511_1564del n/a
Download CSV