Construct: ORF TRCN0000472325
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014884.1_s317c1
- Derived from:
- ccsbBroadEn_02616
- DNA Barcode:
- GATACGGGAGTCCTCCATCTTTTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- DNAJB4 (11080)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472325
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 11080 | DNAJB4 | DnaJ heat shock protein fam... | NM_001317099.1 | 100% | 100% | |
| 2 | human | 11080 | DNAJB4 | DnaJ heat shock protein fam... | NM_007034.5 | 100% | 100% | |
| 3 | human | 11080 | DNAJB4 | DnaJ heat shock protein fam... | NM_001317100.1 | 84.5% | 74.5% | (many diffs) |
| 4 | human | 11080 | DNAJB4 | DnaJ heat shock protein fam... | NM_001317101.1 | 65.8% | 65.8% | 0_1ins345 |
| 5 | human | 11080 | DNAJB4 | DnaJ heat shock protein fam... | NM_001317102.1 | 65.8% | 65.8% | 0_1ins345 |
| 6 | human | 11080 | DNAJB4 | DnaJ heat shock protein fam... | NM_001317103.1 | 22.1% | 21% | (many diffs) |
| 7 | mouse | 67035 | Dnajb4 | DnaJ heat shock protein fam... | NM_025926.4 | 90.5% | 94% | (many diffs) |
| 8 | mouse | 67035 | Dnajb4 | DnaJ heat shock protein fam... | NM_027287.4 | 90.5% | 94% | (many diffs) |
| 9 | mouse | 67035 | Dnajb4 | DnaJ heat shock protein fam... | XM_006501920.3 | 90.5% | 94% | (many diffs) |
| 10 | mouse | 67035 | Dnajb4 | DnaJ heat shock protein fam... | XM_006501921.3 | 59.2% | 61.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1077
- ORF length:
- 1011
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg gaaagactat tattgcattt tgggaattga gaaaggagct tcagatgaag 121 atattaaaaa ggcttaccga aaacaagccc tcaaatttca tccggacaag aacaaatctc 181 ctcaggcaga ggaaaaattt aaagaggtcg cagaagctta tgaagtattg agtgatccta 241 aaaagagaga aatatatgat cagtttgggg aggaagggtt gaaaggagga gcaggaggta 301 ctgatggaca aggaggtacc ttccggtaca cctttcatgg cgatcctcat gctacatttg 361 ctgcattttt cggagggtcc aacccctttg aaattttctt tggaagacga atgggtggtg 421 gtagagattc tgaagaaatg gaaatagatg gtgatccttt tagtgccttt ggtttcagca 481 tgaatggata tccaagagac aggaattctg tggggccatc ccgcctcaaa caagatcctc 541 cagttattca tgaacttaga gtatcacttg aagagatata tagtggttgt accaaacgga 601 tgaagatttc tcgaaaaagg ctaaacgctg atggaaggag ttacagatct gaggacaaaa 661 ttcttaCCAT TGAGATTAAA AAAGGGTGGA AAGAAGGCAC CAAAATTACT TTTCCAAGAG 721 AAGGAGATGA AACACCAAAT AGTATTCCAG CAGACATTGT TTTTATCATT AAAGACAAAG 781 ATCATCCAAA ATTTAAAAGG GATGGATCAA ATATAATTTA TACTGCTAAA ATTAGTTTAC 841 GAGAGGCATT GTGTGGCTGC TCAATTAATG TACCAACACT GGATGGAAGA AACATACCTA 901 TGTCAGTAAA TGATATTGTG AAACCCGGAA TGAGGAGAAG AATTATTGGA TATGGGCTGC 961 CATTTCCAAA AAATCCTGAC CAACGTGGTG ACCTTCTAAT AGAATTTGAG GTGTCCTTCC 1021 CAGATACTAT ATCTTCTTCA TCCAAAGAAG TACTTAGGAA ACATCTTCCT GCCTCATACC 1081 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 1141 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 1201 ATATATCTTG TGGAAAGGAC GAGATACGGG AGTCCTCCAT CTTTTTACGC GTTAAGTCga 1261 caatcaacct ctggattaca aaatttgtga aagatt