Transcript: Human NM_001317099.1

Homo sapiens DnaJ heat shock protein family (Hsp40) member B4 (DNAJB4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
DNAJB4 (11080)
Length:
2917
CDS:
171..1184

Additional Resources:

NCBI RefSeq record:
NM_001317099.1
NBCI Gene record:
DNAJB4 (11080)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001317099.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000454912 GAAGTATTGAGTGATCCTAAA pLKO_005 327 CDS 100% 10.800 15.120 N DNAJB4 n/a
2 TRCN0000022270 CGTGGTGACCTTCTAATAGAA pLKO.1 1089 CDS 100% 5.625 7.875 N DNAJB4 n/a
3 TRCN0000022269 CGGGTCAAATAAATAGGCAAA pLKO.1 1322 3UTR 100% 4.050 5.670 N DNAJB4 n/a
4 TRCN0000022273 GAGCTTCAGATGAAGATATTA pLKO.1 211 CDS 100% 15.000 10.500 N DNAJB4 n/a
5 TRCN0000419874 GTATCACTTGAAGAGATATAT pLKO_005 666 CDS 100% 15.000 10.500 N DNAJB4 n/a
6 TRCN0000022272 TCAAACAAGATCCTCCAGTTA pLKO.1 631 CDS 100% 4.950 3.465 N DNAJB4 n/a
7 TRCN0000022271 CCTCAAATTTCATCCGGACAA pLKO.1 254 CDS 100% 4.050 2.835 N DNAJB4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001317099.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02616 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02616 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472325 GATACGGGAGTCCTCCATCTTTTT pLX_317 40.8% 100% 100% V5 n/a
Download CSV